Incidental Mutation 'R0592:Oas3'
ID56019
Institutional Source Beutler Lab
Gene Symbol Oas3
Ensembl Gene ENSMUSG00000032661
Gene Name2'-5' oligoadenylate synthetase 3
SynonymsOasl10, 2'-5' oligoadenylate synthetase-like 10
MMRRC Submission 038782-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.079) question?
Stock #R0592 (G1)
Quality Score144
Status Validated
Chromosome5
Chromosomal Location120753098-120777661 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 120771149 bp
ZygosityHeterozygous
Amino Acid Change Phenylalanine to Serine at position 244 (F244S)
Ref Sequence ENSEMBL: ENSMUSP00000035588 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000044833]
Predicted Effect probably damaging
Transcript: ENSMUST00000044833
AA Change: F244S

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000035588
Gene: ENSMUSG00000032661
AA Change: F244S

DomainStartEndE-ValueType
Pfam:OAS1_C 159 341 6.3e-83 PFAM
Pfam:OAS1_C 610 795 3.1e-78 PFAM
Pfam:NTP_transf_2 831 920 4.5e-11 PFAM
Pfam:OAS1_C 954 1136 9e-85 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000166703
Meta Mutation Damage Score 0.7861 question?
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.9%
  • 10x: 97.5%
  • 20x: 95.0%
Validation Efficiency 100% (35/35)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes an enzyme included in the 2', 5' oligoadenylate synthase family. This enzyme is induced by interferons and catalyzes the 2', 5' oligomers of adenosine in order to bind and activate RNase L. This enzyme family plays a significant role in the inhibition of cellular protein synthesis and viral infection resistance. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 35 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Atg2a GCCTTCCTTCCTTCCTTCCTTCCTTCCTTCCTTCC GCCTTCCTTCCTTCCTTCCTTCCTTCCTTCCTTCCTTCC 19: 6,245,007 probably benign Het
Bbs7 A T 3: 36,610,297 V53D probably benign Het
Bglap T A 3: 88,383,655 I90F probably benign Het
C2cd4b G A 9: 67,760,691 R323H probably damaging Het
Cdh5 T A 8: 104,130,902 probably null Het
Cdh8 T A 8: 99,279,478 D159V probably damaging Het
Dnah7a A G 1: 53,456,612 Y3229H possibly damaging Het
Dzip1 T C 14: 118,902,139 E381G probably damaging Het
Elmod1 A G 9: 53,926,106 probably benign Het
Exosc10 T C 4: 148,581,113 S811P probably benign Het
Fhl3 A G 4: 124,705,677 Y15C probably benign Het
Gstz1 G A 12: 87,163,721 S126N probably benign Het
Hey2 C A 10: 30,833,957 A267S probably benign Het
Iqce A T 5: 140,686,107 probably null Het
Katnal2 A T 18: 77,002,560 probably null Het
Kdm2b G A 5: 122,961,134 probably benign Het
Mov10l1 A G 15: 88,998,766 probably null Het
Numa1 A G 7: 102,013,897 T724A probably benign Het
Olfr1472 T C 19: 13,453,705 I271V probably benign Het
Olfr715 G A 7: 107,129,343 L17F probably benign Het
Ppil2 A G 16: 17,107,219 S30P probably benign Het
Rab37 T G 11: 115,160,523 probably benign Het
Riox2 T C 16: 59,489,579 probably benign Het
Ryr3 A G 2: 112,678,481 S3358P probably damaging Het
Sash1 T A 10: 8,729,782 H948L probably benign Het
Serpinb6e T A 13: 33,841,074 N78I probably damaging Het
Slc25a47 G A 12: 108,854,258 V63M probably damaging Het
Slc9b1 A T 3: 135,394,074 probably benign Het
Strip2 T A 6: 29,931,210 S387T probably benign Het
Tcaf3 T C 6: 42,596,843 N145S probably benign Het
Tex10 C T 4: 48,456,800 R637Q probably benign Het
Trmu T C 15: 85,896,826 probably benign Het
Vezf1 A T 11: 88,068,435 probably benign Het
Vmn2r116 C T 17: 23,386,915 T267I probably damaging Het
Whrn C A 4: 63,415,567 A450S probably damaging Het
Other mutations in Oas3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00547:Oas3 APN 5 120777442 splice site probably benign
IGL01095:Oas3 APN 5 120772889 missense probably damaging 1.00
IGL01835:Oas3 APN 5 120766128 nonsense probably null
IGL02006:Oas3 APN 5 120769235 missense probably benign 0.00
IGL02811:Oas3 APN 5 120764322 missense unknown
IGL03194:Oas3 APN 5 120758953 missense probably damaging 1.00
R0066:Oas3 UTSW 5 120758875 missense probably damaging 1.00
R0195:Oas3 UTSW 5 120756145 missense probably damaging 1.00
R0196:Oas3 UTSW 5 120756145 missense probably damaging 1.00
R0197:Oas3 UTSW 5 120756145 missense probably damaging 1.00
R0445:Oas3 UTSW 5 120756145 missense probably damaging 1.00
R0523:Oas3 UTSW 5 120766144 missense unknown
R0946:Oas3 UTSW 5 120769063 missense unknown
R1354:Oas3 UTSW 5 120770000 missense possibly damaging 0.94
R1642:Oas3 UTSW 5 120777574 missense possibly damaging 0.90
R1681:Oas3 UTSW 5 120769908 missense probably benign 0.22
R1844:Oas3 UTSW 5 120759980 missense probably damaging 0.99
R1981:Oas3 UTSW 5 120761835 splice site probably benign
R2443:Oas3 UTSW 5 120777488 missense probably benign 0.35
R2902:Oas3 UTSW 5 120758917 missense probably damaging 1.00
R3034:Oas3 UTSW 5 120771056 missense probably damaging 1.00
R4565:Oas3 UTSW 5 120771039 missense probably damaging 1.00
R4692:Oas3 UTSW 5 120769355 missense probably benign 0.03
R4723:Oas3 UTSW 5 120766256 missense unknown
R4812:Oas3 UTSW 5 120761147 unclassified probably benign
R5288:Oas3 UTSW 5 120756990 missense probably damaging 1.00
R5343:Oas3 UTSW 5 120756238 missense possibly damaging 0.70
R5494:Oas3 UTSW 5 120761644 missense unknown
R5688:Oas3 UTSW 5 120758802 missense probably benign 0.31
R5894:Oas3 UTSW 5 120756954 missense probably damaging 1.00
R5921:Oas3 UTSW 5 120769981 missense probably damaging 1.00
R6037:Oas3 UTSW 5 120769319 missense probably benign 0.41
R6037:Oas3 UTSW 5 120769319 missense probably benign 0.41
R6066:Oas3 UTSW 5 120772924 missense probably damaging 0.97
R6104:Oas3 UTSW 5 120761693 missense unknown
R6134:Oas3 UTSW 5 120769048 missense unknown
R6255:Oas3 UTSW 5 120771230 missense probably benign 0.04
R6257:Oas3 UTSW 5 120761135 unclassified probably benign
R6776:Oas3 UTSW 5 120758874 missense probably damaging 1.00
RF006:Oas3 UTSW 5 120774100 missense probably damaging 1.00
X0024:Oas3 UTSW 5 120761728 missense unknown
Predicted Primers PCR Primer
(F):5'- ATTAAACAGGCACGGTGTGAGCCC -3'
(R):5'- TGAAACCCCACAGTAGGCAGATGAG -3'

Sequencing Primer
(F):5'- CCCAAGTGTTTAATCAACCAGG -3'
(R):5'- GCTATCTGAGGAAGCAGTTCAC -3'
Posted On2013-07-11