Incidental Mutation 'R0592:Iqce'
ID56021
Institutional Source Beutler Lab
Gene Symbol Iqce
Ensembl Gene ENSMUSG00000036555
Gene NameIQ motif containing E
Synonyms1700028P05Rik
MMRRC Submission 038782-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R0592 (G1)
Quality Score169
Status Validated
Chromosome5
Chromosomal Location140661827-140702378 bp(-) (GRCm38)
Type of Mutationunclassified
DNA Base Change (assembly) A to T at 140686107 bp
ZygosityHeterozygous
Amino Acid Change
Gene Model predicted gene model for transcript(s): [ENSMUST00000041783] [ENSMUST00000041783] [ENSMUST00000041783] [ENSMUST00000077890] [ENSMUST00000077890] [ENSMUST00000077890] [ENSMUST00000142081]
Predicted Effect probably null
Transcript: ENSMUST00000041783
SMART Domains Protein: ENSMUSP00000045913
Gene: ENSMUSG00000036555

DomainStartEndE-ValueType
low complexity region 33 53 N/A INTRINSIC
low complexity region 128 139 N/A INTRINSIC
coiled coil region 157 190 N/A INTRINSIC
coiled coil region 212 266 N/A INTRINSIC
coiled coil region 287 323 N/A INTRINSIC
low complexity region 345 362 N/A INTRINSIC
coiled coil region 398 491 N/A INTRINSIC
IQ 552 574 1.36e-3 SMART
low complexity region 579 598 N/A INTRINSIC
IQ 614 636 1.63e-1 SMART
low complexity region 734 753 N/A INTRINSIC
low complexity region 754 766 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000041783
SMART Domains Protein: ENSMUSP00000045913
Gene: ENSMUSG00000036555

DomainStartEndE-ValueType
low complexity region 33 53 N/A INTRINSIC
low complexity region 128 139 N/A INTRINSIC
coiled coil region 157 190 N/A INTRINSIC
coiled coil region 212 266 N/A INTRINSIC
coiled coil region 287 323 N/A INTRINSIC
low complexity region 345 362 N/A INTRINSIC
coiled coil region 398 491 N/A INTRINSIC
IQ 552 574 1.36e-3 SMART
low complexity region 579 598 N/A INTRINSIC
IQ 614 636 1.63e-1 SMART
low complexity region 734 753 N/A INTRINSIC
low complexity region 754 766 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000041783
SMART Domains Protein: ENSMUSP00000045913
Gene: ENSMUSG00000036555

DomainStartEndE-ValueType
low complexity region 33 53 N/A INTRINSIC
low complexity region 128 139 N/A INTRINSIC
coiled coil region 157 190 N/A INTRINSIC
coiled coil region 212 266 N/A INTRINSIC
coiled coil region 287 323 N/A INTRINSIC
low complexity region 345 362 N/A INTRINSIC
coiled coil region 398 491 N/A INTRINSIC
IQ 552 574 1.36e-3 SMART
low complexity region 579 598 N/A INTRINSIC
IQ 614 636 1.63e-1 SMART
low complexity region 734 753 N/A INTRINSIC
low complexity region 754 766 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000077890
SMART Domains Protein: ENSMUSP00000077050
Gene: ENSMUSG00000036555

DomainStartEndE-ValueType
low complexity region 33 53 N/A INTRINSIC
coiled coil region 112 145 N/A INTRINSIC
coiled coil region 167 221 N/A INTRINSIC
coiled coil region 242 278 N/A INTRINSIC
low complexity region 300 317 N/A INTRINSIC
coiled coil region 353 446 N/A INTRINSIC
IQ 507 529 1.36e-3 SMART
low complexity region 534 553 N/A INTRINSIC
IQ 569 591 1.63e-1 SMART
low complexity region 628 647 N/A INTRINSIC
low complexity region 717 736 N/A INTRINSIC
low complexity region 737 749 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000077890
SMART Domains Protein: ENSMUSP00000077050
Gene: ENSMUSG00000036555

DomainStartEndE-ValueType
low complexity region 33 53 N/A INTRINSIC
coiled coil region 112 145 N/A INTRINSIC
coiled coil region 167 221 N/A INTRINSIC
coiled coil region 242 278 N/A INTRINSIC
low complexity region 300 317 N/A INTRINSIC
coiled coil region 353 446 N/A INTRINSIC
IQ 507 529 1.36e-3 SMART
low complexity region 534 553 N/A INTRINSIC
IQ 569 591 1.63e-1 SMART
low complexity region 628 647 N/A INTRINSIC
low complexity region 717 736 N/A INTRINSIC
low complexity region 737 749 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000077890
SMART Domains Protein: ENSMUSP00000077050
Gene: ENSMUSG00000036555

DomainStartEndE-ValueType
low complexity region 33 53 N/A INTRINSIC
coiled coil region 112 145 N/A INTRINSIC
coiled coil region 167 221 N/A INTRINSIC
coiled coil region 242 278 N/A INTRINSIC
low complexity region 300 317 N/A INTRINSIC
coiled coil region 353 446 N/A INTRINSIC
IQ 507 529 1.36e-3 SMART
low complexity region 534 553 N/A INTRINSIC
IQ 569 591 1.63e-1 SMART
low complexity region 628 647 N/A INTRINSIC
low complexity region 717 736 N/A INTRINSIC
low complexity region 737 749 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000123683
Predicted Effect noncoding transcript
Transcript: ENSMUST00000124005
Predicted Effect probably null
Transcript: ENSMUST00000129704
SMART Domains Protein: ENSMUSP00000121457
Gene: ENSMUSG00000036555

DomainStartEndE-ValueType
coiled coil region 1 33 N/A INTRINSIC
low complexity region 42 52 N/A INTRINSIC
coiled coil region 88 181 N/A INTRINSIC
IQ 186 208 1.36e-3 SMART
low complexity region 213 232 N/A INTRINSIC
IQ 248 270 1.63e-1 SMART
low complexity region 312 331 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000136385
Predicted Effect probably benign
Transcript: ENSMUST00000142081
SMART Domains Protein: ENSMUSP00000120637
Gene: ENSMUSG00000036555

DomainStartEndE-ValueType
low complexity region 33 53 N/A INTRINSIC
low complexity region 128 139 N/A INTRINSIC
coiled coil region 157 185 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000149674
Meta Mutation Damage Score 0.9755 question?
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.9%
  • 10x: 97.5%
  • 20x: 95.0%
Validation Efficiency 100% (35/35)
Allele List at MGI
Other mutations in this stock
Total: 35 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Atg2a GCCTTCCTTCCTTCCTTCCTTCCTTCCTTCCTTCC GCCTTCCTTCCTTCCTTCCTTCCTTCCTTCCTTCCTTCC 19: 6,245,007 probably benign Het
Bbs7 A T 3: 36,610,297 V53D probably benign Het
Bglap T A 3: 88,383,655 I90F probably benign Het
C2cd4b G A 9: 67,760,691 R323H probably damaging Het
Cdh5 T A 8: 104,130,902 probably null Het
Cdh8 T A 8: 99,279,478 D159V probably damaging Het
Dnah7a A G 1: 53,456,612 Y3229H possibly damaging Het
Dzip1 T C 14: 118,902,139 E381G probably damaging Het
Elmod1 A G 9: 53,926,106 probably benign Het
Exosc10 T C 4: 148,581,113 S811P probably benign Het
Fhl3 A G 4: 124,705,677 Y15C probably benign Het
Gstz1 G A 12: 87,163,721 S126N probably benign Het
Hey2 C A 10: 30,833,957 A267S probably benign Het
Katnal2 A T 18: 77,002,560 probably null Het
Kdm2b G A 5: 122,961,134 probably benign Het
Mov10l1 A G 15: 88,998,766 probably null Het
Numa1 A G 7: 102,013,897 T724A probably benign Het
Oas3 A G 5: 120,771,149 F244S probably damaging Het
Olfr1472 T C 19: 13,453,705 I271V probably benign Het
Olfr715 G A 7: 107,129,343 L17F probably benign Het
Ppil2 A G 16: 17,107,219 S30P probably benign Het
Rab37 T G 11: 115,160,523 probably benign Het
Riox2 T C 16: 59,489,579 probably benign Het
Ryr3 A G 2: 112,678,481 S3358P probably damaging Het
Sash1 T A 10: 8,729,782 H948L probably benign Het
Serpinb6e T A 13: 33,841,074 N78I probably damaging Het
Slc25a47 G A 12: 108,854,258 V63M probably damaging Het
Slc9b1 A T 3: 135,394,074 probably benign Het
Strip2 T A 6: 29,931,210 S387T probably benign Het
Tcaf3 T C 6: 42,596,843 N145S probably benign Het
Tex10 C T 4: 48,456,800 R637Q probably benign Het
Trmu T C 15: 85,896,826 probably benign Het
Vezf1 A T 11: 88,068,435 probably benign Het
Vmn2r116 C T 17: 23,386,915 T267I probably damaging Het
Whrn C A 4: 63,415,567 A450S probably damaging Het
Other mutations in Iqce
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00591:Iqce APN 5 140678128 nonsense probably null
IGL01862:Iqce APN 5 140699725 missense possibly damaging 0.93
R0255:Iqce UTSW 5 140666202 missense possibly damaging 0.62
R0492:Iqce UTSW 5 140675235 missense probably damaging 0.99
R0580:Iqce UTSW 5 140665401 missense possibly damaging 0.85
R2177:Iqce UTSW 5 140691593 splice site probably benign
R4849:Iqce UTSW 5 140693459 missense possibly damaging 0.84
R4979:Iqce UTSW 5 140691621 missense probably damaging 1.00
R5007:Iqce UTSW 5 140675248 missense possibly damaging 0.48
R5341:Iqce UTSW 5 140690059 missense possibly damaging 0.95
R5558:Iqce UTSW 5 140671805 critical splice donor site probably null
R5765:Iqce UTSW 5 140666140 missense probably damaging 0.99
R5910:Iqce UTSW 5 140702218 unclassified probably benign
R6354:Iqce UTSW 5 140676335 intron probably null
R6732:Iqce UTSW 5 140675235 missense probably benign
R7050:Iqce UTSW 5 140666091 missense possibly damaging 0.76
R7238:Iqce UTSW 5 140689958 nonsense probably null
R7567:Iqce UTSW 5 140686075 missense probably damaging 1.00
R7735:Iqce UTSW 5 140678084 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- GCACTGCCCTTAATAAGCATTGCAC -3'
(R):5'- TGTGGTCAAGGTCAACGCCATC -3'

Sequencing Primer
(F):5'- TTAATAAGCATTGCACAACTCCC -3'
(R):5'- ACTTGGGTTTCCAGCAAACTG -3'
Posted On2013-07-11