Incidental Mutation 'R7200:Hjurp'
ID 560213
Institutional Source Beutler Lab
Gene Symbol Hjurp
Ensembl Gene ENSMUSG00000044783
Gene Name Holliday junction recognition protein
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.908) question?
Stock # R7200 (G1)
Quality Score 217.468
Status Not validated
Chromosome 1
Chromosomal Location 88262471-88277633 bp(-) (GRCm38)
Type of Mutation utr 3 prime
DNA Base Change (assembly) TCTGGGAGGGCTTGCTCCGGGGGCAGTGTGTCCTGTTCTTGTGCAGCCCCTGCT to TCT at 88266278 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000120753 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000054674] [ENSMUST00000061013] [ENSMUST00000065420] [ENSMUST00000113130] [ENSMUST00000127446] [ENSMUST00000147393]
AlphaFold no structure available at present
Predicted Effect probably benign
Transcript: ENSMUST00000054674
SMART Domains Protein: ENSMUSP00000054263
Gene: ENSMUSG00000044783

DomainStartEndE-ValueType
Pfam:Scm3 11 68 1.5e-10 PFAM
low complexity region 159 175 N/A INTRINSIC
low complexity region 215 232 N/A INTRINSIC
Pfam:HJURP_mid 254 370 7.6e-54 PFAM
Pfam:HJURP_C 385 446 3.1e-26 PFAM
low complexity region 496 515 N/A INTRINSIC
Pfam:HJURP_C 527 585 7.1e-21 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000061013
SMART Domains Protein: ENSMUSP00000130508
Gene: ENSMUSG00000079429

DomainStartEndE-ValueType
low complexity region 9 26 N/A INTRINSIC
low complexity region 99 112 N/A INTRINSIC
low complexity region 1235 1248 N/A INTRINSIC
SCOP:d1jdha_ 1371 1669 9e-8 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000065420
SMART Domains Protein: ENSMUSP00000070419
Gene: ENSMUSG00000044783

DomainStartEndE-ValueType
Pfam:Scm3 9 70 2.9e-11 PFAM
low complexity region 83 99 N/A INTRINSIC
low complexity region 139 156 N/A INTRINSIC
Pfam:HJURP_mid 178 295 7.4e-64 PFAM
Pfam:HJURP_C 309 371 1.2e-26 PFAM
low complexity region 420 439 N/A INTRINSIC
Pfam:HJURP_C 451 510 3e-26 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000113130
SMART Domains Protein: ENSMUSP00000108755
Gene: ENSMUSG00000079429

DomainStartEndE-ValueType
low complexity region 9 26 N/A INTRINSIC
low complexity region 99 112 N/A INTRINSIC
low complexity region 1232 1245 N/A INTRINSIC
SCOP:d1gw5a_ 1446 1671 6e-6 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000127446
Predicted Effect probably benign
Transcript: ENSMUST00000147393
SMART Domains Protein: ENSMUSP00000120753
Gene: ENSMUSG00000044783

DomainStartEndE-ValueType
Pfam:Scm3 9 70 7.2e-13 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.4%
  • 20x: 97.8%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 51 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700086D15Rik A G 11: 65,153,010 M75T unknown Het
2700049A03Rik T G 12: 71,140,906 N105K probably damaging Het
Acvr1c A T 2: 58,315,855 V31E probably damaging Het
Adra1d T A 2: 131,561,250 T307S probably benign Het
Akr1c14 T C 13: 4,081,051 Y248H probably benign Het
Ankub1 T C 3: 57,672,985 T84A probably benign Het
Asb3 C A 11: 30,998,348 S8* probably null Het
AU041133 G A 10: 82,151,101 G196D possibly damaging Het
B4galt7 T C 13: 55,608,342 C214R probably damaging Het
Chd3 A G 11: 69,364,095 S140P possibly damaging Het
Ciz1 T C 2: 32,364,287 L80P probably damaging Het
Col6a4 G A 9: 106,072,249 P729L possibly damaging Het
Cr2 A G 1: 195,163,249 C133R probably damaging Het
Dmgdh T C 13: 93,691,885 L178P probably damaging Het
Dock5 C A 14: 67,771,702 E1448* probably null Het
Elavl1 A G 8: 4,311,767 S2P probably benign Het
Flywch1 T C 17: 23,761,059 H247R possibly damaging Het
Gabpb1 A T 2: 126,639,302 I309N possibly damaging Het
Glrx3 T C 7: 137,464,436 F298L possibly damaging Het
Gm9573 TCCTGAGGCAGTGCTGGATACAGGGGTGGTTGGGGTGGGTGAAGAGCCTGAGGCAGTGCTGGAT TCCTGAGGCAGTGCTGGAT 17: 35,622,633 probably benign Het
Gpc6 G A 14: 117,964,856 V493I probably benign Het
H2-Bl A T 17: 36,081,046 I45N possibly damaging Het
Hadha C T 5: 30,145,317 E78K probably benign Het
Ldlrad3 G T 2: 102,113,558 F56L probably damaging Het
Ldlrad3 A G 2: 102,113,560 F56L probably damaging Het
Mapk4 A T 18: 73,930,919 S411T possibly damaging Het
Mcm9 A G 10: 53,615,923 M382T Het
Olfr1457 T C 19: 13,095,232 T139A probably benign Het
Olfr720 A T 14: 14,175,477 C202S probably damaging Het
Pacs1 A C 19: 5,156,413 I248S possibly damaging Het
Pi16 C A 17: 29,319,234 P7Q possibly damaging Het
Plekhg1 T C 10: 3,956,810 S631P Het
Rars2 A T 4: 34,645,747 K221N probably benign Het
Retsat T C 6: 72,606,019 S388P possibly damaging Het
Rft1 G A 14: 30,682,857 probably null Het
Rgsl1 A G 1: 153,785,199 V345A probably benign Het
Rnf38 A T 4: 44,137,620 S320R probably benign Het
Sel1l3 T A 5: 53,144,109 Y722F probably benign Het
Slc13a4 T C 6: 35,287,350 E194G possibly damaging Het
Spata17 G A 1: 187,112,503 R300C probably benign Het
Tacc1 G A 8: 25,241,640 probably benign Het
Tc2n T G 12: 101,689,055 I214L probably damaging Het
Tet2 T C 3: 133,487,192 S494G probably benign Het
Tmco5b A T 2: 113,291,377 I179L probably damaging Het
Triobp AGGGACAATCCCAGGGCCTCCTCTCCCAACAGAACTACTCAGCGGGACAA AGGGACAA 15: 78,966,842 probably benign Het
Trpv1 A G 11: 73,239,586 T173A probably damaging Het
Vmn2r56 C T 7: 12,710,332 G458R probably damaging Het
Vmn2r81 T G 10: 79,270,736 probably null Het
Wfdc15b T A 2: 164,215,117 E80D probably benign Het
Wrn A T 8: 33,322,348 D423E probably benign Het
Zfp775 T A 6: 48,620,481 C430S possibly damaging Het
Other mutations in Hjurp
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00990:Hjurp APN 1 88270269 missense probably benign 0.04
IGL03099:Hjurp APN 1 88266289 missense probably benign 0.09
BB003:Hjurp UTSW 1 88266278 utr 3 prime probably benign
IGL03097:Hjurp UTSW 1 88266280 utr 3 prime probably benign
IGL03098:Hjurp UTSW 1 88266280 utr 3 prime probably benign
IGL03147:Hjurp UTSW 1 88266280 utr 3 prime probably benign
PIT4131001:Hjurp UTSW 1 88266278 utr 3 prime probably benign
PIT4142001:Hjurp UTSW 1 88266046 missense probably damaging 0.98
PIT4142001:Hjurp UTSW 1 88266278 utr 3 prime probably benign
PIT4142001:Hjurp UTSW 1 88266561 utr 3 prime probably benign
PIT4142001:Hjurp UTSW 1 88266616 missense probably benign 0.04
PIT4378001:Hjurp UTSW 1 88266277 utr 3 prime probably benign
PIT4812001:Hjurp UTSW 1 88266277 utr 3 prime probably benign
R0053:Hjurp UTSW 1 88277215 splice site probably benign
R0371:Hjurp UTSW 1 88277368 splice site probably benign
R0442:Hjurp UTSW 1 88266524 nonsense probably null
R0762:Hjurp UTSW 1 88277215 splice site probably benign
R0928:Hjurp UTSW 1 88266524 nonsense probably null
R1333:Hjurp UTSW 1 88266046 missense probably damaging 0.98
R1342:Hjurp UTSW 1 88277368 splice site probably benign
R1364:Hjurp UTSW 1 88266525 frame shift probably null
R1496:Hjurp UTSW 1 88275050 missense possibly damaging 0.59
R1637:Hjurp UTSW 1 88266121 missense probably benign 0.03
R1905:Hjurp UTSW 1 88266616 missense probably benign 0.04
R1965:Hjurp UTSW 1 88266524 nonsense probably null
R1992:Hjurp UTSW 1 88266524 nonsense probably null
R2002:Hjurp UTSW 1 88266524 nonsense probably null
R2023:Hjurp UTSW 1 88266524 nonsense probably null
R2024:Hjurp UTSW 1 88266524 nonsense probably null
R2332:Hjurp UTSW 1 88277215 splice site probably benign
R2420:Hjurp UTSW 1 88266524 nonsense probably null
R2422:Hjurp UTSW 1 88266561 utr 3 prime probably benign
R2869:Hjurp UTSW 1 88266524 nonsense probably null
R2870:Hjurp UTSW 1 88266524 nonsense probably null
R2871:Hjurp UTSW 1 88266524 nonsense probably null
R2872:Hjurp UTSW 1 88266524 nonsense probably null
R3019:Hjurp UTSW 1 88266524 nonsense probably null
R3021:Hjurp UTSW 1 88266524 nonsense probably null
R3150:Hjurp UTSW 1 88266561 utr 3 prime probably benign
R3411:Hjurp UTSW 1 88266524 nonsense probably null
R3552:Hjurp UTSW 1 88266524 nonsense probably null
R3704:Hjurp UTSW 1 88277215 splice site probably benign
R3730:Hjurp UTSW 1 88266524 nonsense probably null
R3733:Hjurp UTSW 1 88266524 nonsense probably null
R3764:Hjurp UTSW 1 88266524 nonsense probably null
R3799:Hjurp UTSW 1 88277215 splice site probably benign
R3819:Hjurp UTSW 1 88277215 splice site probably benign
R3857:Hjurp UTSW 1 88266524 nonsense probably null
R3930:Hjurp UTSW 1 88266524 nonsense probably null
R3952:Hjurp UTSW 1 88277215 splice site probably benign
R4090:Hjurp UTSW 1 88277215 splice site probably benign
R4159:Hjurp UTSW 1 88277215 splice site probably benign
R4207:Hjurp UTSW 1 88277215 splice site probably benign
R4322:Hjurp UTSW 1 88277215 splice site probably benign
R4391:Hjurp UTSW 1 88266561 utr 3 prime probably benign
R4392:Hjurp UTSW 1 88266524 nonsense probably null
R4393:Hjurp UTSW 1 88266524 nonsense probably null
R4393:Hjurp UTSW 1 88266561 utr 3 prime probably benign
R4397:Hjurp UTSW 1 88266524 nonsense probably null
R4700:Hjurp UTSW 1 88266524 nonsense probably null
R4808:Hjurp UTSW 1 88277215 splice site probably benign
R4900:Hjurp UTSW 1 88266524 nonsense probably null
R4901:Hjurp UTSW 1 88266524 nonsense probably null
R5023:Hjurp UTSW 1 88275050 missense possibly damaging 0.59
R5024:Hjurp UTSW 1 88275050 missense possibly damaging 0.59
R5076:Hjurp UTSW 1 88266524 nonsense probably null
R5123:Hjurp UTSW 1 88275050 missense possibly damaging 0.59
R5236:Hjurp UTSW 1 88266524 nonsense probably null
R5300:Hjurp UTSW 1 88266524 nonsense probably null
R5318:Hjurp UTSW 1 88266524 nonsense probably null
R5370:Hjurp UTSW 1 88266524 nonsense probably null
R5410:Hjurp UTSW 1 88266524 nonsense probably null
R5445:Hjurp UTSW 1 88266316 missense probably benign 0.43
R5457:Hjurp UTSW 1 88266525 frame shift probably null
R5497:Hjurp UTSW 1 88266320 missense possibly damaging 0.92
R5560:Hjurp UTSW 1 88266524 nonsense probably null
R5561:Hjurp UTSW 1 88266524 nonsense probably null
R5615:Hjurp UTSW 1 88266524 nonsense probably null
R5661:Hjurp UTSW 1 88277215 splice site probably benign
R5722:Hjurp UTSW 1 88266524 nonsense probably null
R6087:Hjurp UTSW 1 88266524 nonsense probably null
R6089:Hjurp UTSW 1 88266524 nonsense probably null
R6090:Hjurp UTSW 1 88266524 nonsense probably null
R6125:Hjurp UTSW 1 88266524 nonsense probably null
R6175:Hjurp UTSW 1 88266524 nonsense probably null
R6362:Hjurp UTSW 1 88275050 missense possibly damaging 0.59
R6659:Hjurp UTSW 1 88266524 nonsense probably null
R7016:Hjurp UTSW 1 88266277 utr 3 prime probably benign
R7016:Hjurp UTSW 1 88266278 utr 3 prime probably benign
R7045:Hjurp UTSW 1 88266278 utr 3 prime probably benign
R7179:Hjurp UTSW 1 88266278 utr 3 prime probably benign
R7463:Hjurp UTSW 1 88266277 utr 3 prime probably benign
R7912:Hjurp UTSW 1 88266278 utr 3 prime probably benign
R8215:Hjurp UTSW 1 88266524 nonsense probably null
R8968:Hjurp UTSW 1 88266277 utr 3 prime probably benign
R9038:Hjurp UTSW 1 88266524 nonsense probably null
R9115:Hjurp UTSW 1 88266277 utr 3 prime probably benign
R9133:Hjurp UTSW 1 88275050 missense possibly damaging 0.59
R9146:Hjurp UTSW 1 88266278 utr 3 prime probably benign
R9221:Hjurp UTSW 1 88266277 utr 3 prime probably benign
R9475:Hjurp UTSW 1 88266277 utr 3 prime probably benign
R9482:Hjurp UTSW 1 88266274 utr 3 prime probably benign
R9565:Hjurp UTSW 1 88266278 utr 3 prime probably benign
R9599:Hjurp UTSW 1 88266278 utr 3 prime probably benign
V5622:Hjurp UTSW 1 88277525 unclassified probably benign
Predicted Primers PCR Primer
(F):5'- TTCTGCGGCATCATCTGGAG -3'
(R):5'- TTGATGACCTTTGCAATGTGAC -3'

Sequencing Primer
(F):5'- ATCATCTGGAGCTCCTTCCAAG -3'
(R):5'- CCTTTGCAATGTGACAATCAGCG -3'
Posted On 2019-06-26