Incidental Mutation 'R7200:Acvr1c'
ID560218
Institutional Source Beutler Lab
Gene Symbol Acvr1c
Ensembl Gene ENSMUSG00000026834
Gene Nameactivin A receptor, type IC
SynonymsALK7, Alk-7
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R7200 (G1)
Quality Score225.009
Status Not validated
Chromosome2
Chromosomal Location58267453-58357895 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 58315855 bp
ZygosityHeterozygous
Amino Acid Change Valine to Glutamic Acid at position 31 (V31E)
Ref Sequence ENSEMBL: ENSMUSP00000097663 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000028178] [ENSMUST00000100085] [ENSMUST00000112607] [ENSMUST00000112608] [ENSMUST00000154453]
Predicted Effect probably benign
Transcript: ENSMUST00000028178
AA Change: V81E

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000028178
Gene: ENSMUSG00000026834
AA Change: V81E

DomainStartEndE-ValueType
signal peptide 1 25 N/A INTRINSIC
Pfam:Activin_recp 26 100 3.1e-13 PFAM
transmembrane domain 114 136 N/A INTRINSIC
GS 165 195 1.07e-13 SMART
Blast:TyrKc 201 472 3e-28 BLAST
Predicted Effect probably damaging
Transcript: ENSMUST00000100085
AA Change: V31E

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000097663
Gene: ENSMUSG00000026834
AA Change: V31E

DomainStartEndE-ValueType
Pfam:Activin_recp 1 50 1.1e-7 PFAM
Pfam:TGF_beta_GS 51 63 2.6e-7 PFAM
Pfam:Pkinase 65 352 5.6e-51 PFAM
Pfam:Pkinase_Tyr 65 352 4e-34 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000112607
AA Change: V81E

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000108226
Gene: ENSMUSG00000026834
AA Change: V81E

DomainStartEndE-ValueType
signal peptide 1 25 N/A INTRINSIC
Pfam:Activin_recp 26 100 3.5e-15 PFAM
Pfam:Pkinase 51 325 9.5e-37 PFAM
Pfam:Pkinase_Tyr 92 325 4.8e-24 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000112608
AA Change: V81E

PolyPhen 2 Score 0.122 (Sensitivity: 0.93; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000108227
Gene: ENSMUSG00000026834
AA Change: V81E

DomainStartEndE-ValueType
signal peptide 1 25 N/A INTRINSIC
Pfam:Activin_recp 26 100 4.9e-15 PFAM
Pfam:TGF_beta_GS 101 113 1.2e-8 PFAM
Pfam:Pkinase 115 402 2.3e-51 PFAM
Pfam:Pkinase_Tyr 115 402 1.6e-34 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000154453
AA Change: V31E

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000119776
Gene: ENSMUSG00000026834
AA Change: V31E

DomainStartEndE-ValueType
Pfam:Activin_recp 1 50 2.7e-9 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.4%
  • 20x: 97.8%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] ACVR1C is a type I receptor for the TGFB (see MIM 190180) family of signaling molecules. Upon ligand binding, type I receptors phosphorylate cytoplasmic SMAD transcription factors, which then translocate to the nucleus and interact directly with DNA or in complex with other transcription factors (Bondestam et al., 2001 [PubMed 12063393]).[supplied by OMIM, Mar 2008]
PHENOTYPE: Mice homozygous for a knock-out allele are viable, fertile, and overtly normal with no apparent left-right patterning abnormalities or organogenesis defects. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 51 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700086D15Rik A G 11: 65,153,010 M75T unknown Het
2700049A03Rik T G 12: 71,140,906 N105K probably damaging Het
Adra1d T A 2: 131,561,250 T307S probably benign Het
Akr1c14 T C 13: 4,081,051 Y248H probably benign Het
Ankub1 T C 3: 57,672,985 T84A probably benign Het
Asb3 C A 11: 30,998,348 S8* probably null Het
AU041133 G A 10: 82,151,101 G196D possibly damaging Het
B4galt7 T C 13: 55,608,342 C214R probably damaging Het
Chd3 A G 11: 69,364,095 S140P possibly damaging Het
Ciz1 T C 2: 32,364,287 L80P probably damaging Het
Col6a4 G A 9: 106,072,249 P729L possibly damaging Het
Cr2 A G 1: 195,163,249 C133R probably damaging Het
Dmgdh T C 13: 93,691,885 L178P probably damaging Het
Dock5 C A 14: 67,771,702 E1448* probably null Het
Elavl1 A G 8: 4,311,767 S2P probably benign Het
Flywch1 T C 17: 23,761,059 H247R possibly damaging Het
Gabpb1 A T 2: 126,639,302 I309N possibly damaging Het
Glrx3 T C 7: 137,464,436 F298L possibly damaging Het
Gm9573 TCCTGAGGCAGTGCTGGATACAGGGGTGGTTGGGGTGGGTGAAGAGCCTGAGGCAGTGCTGGAT TCCTGAGGCAGTGCTGGAT 17: 35,622,633 probably benign Het
Gpc6 G A 14: 117,964,856 V493I probably benign Het
H2-Bl A T 17: 36,081,046 I45N possibly damaging Het
Hadha C T 5: 30,145,317 E78K probably benign Het
Hjurp TCTGGGAGGGCTTGCTCCGGGGGCAGTGTGTCCTGTTCTTGTGCAGCCCCTGCT TCT 1: 88,266,278 probably benign Het
Ldlrad3 G T 2: 102,113,558 F56L probably damaging Het
Ldlrad3 A G 2: 102,113,560 F56L probably damaging Het
Mapk4 A T 18: 73,930,919 S411T possibly damaging Het
Mcm9 A G 10: 53,615,923 M382T Het
Olfr1457 T C 19: 13,095,232 T139A probably benign Het
Olfr720 A T 14: 14,175,477 C202S probably damaging Het
Pacs1 A C 19: 5,156,413 I248S possibly damaging Het
Pi16 C A 17: 29,319,234 P7Q possibly damaging Het
Plekhg1 T C 10: 3,956,810 S631P Het
Rars2 A T 4: 34,645,747 K221N probably benign Het
Retsat T C 6: 72,606,019 S388P possibly damaging Het
Rft1 G A 14: 30,682,857 probably null Het
Rgsl1 A G 1: 153,785,199 V345A probably benign Het
Rnf38 A T 4: 44,137,620 S320R probably benign Het
Sel1l3 T A 5: 53,144,109 Y722F probably benign Het
Slc13a4 T C 6: 35,287,350 E194G possibly damaging Het
Spata17 G A 1: 187,112,503 R300C probably benign Het
Tacc1 G A 8: 25,241,640 probably benign Het
Tc2n T G 12: 101,689,055 I214L probably damaging Het
Tet2 T C 3: 133,487,192 S494G probably benign Het
Tmco5b A T 2: 113,291,377 I179L probably damaging Het
Triobp AGGGACAATCCCAGGGCCTCCTCTCCCAACAGAACTACTCAGCGGGACAA AGGGACAA 15: 78,966,842 probably benign Het
Trpv1 A G 11: 73,239,586 T173A probably damaging Het
Vmn2r56 C T 7: 12,710,332 G458R probably damaging Het
Vmn2r81 T G 10: 79,270,736 probably null Het
Wfdc15b T A 2: 164,215,117 E80D probably benign Het
Wrn A T 8: 33,322,348 D423E probably benign Het
Zfp775 T A 6: 48,620,481 C430S possibly damaging Het
Other mutations in Acvr1c
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00480:Acvr1c APN 2 58315855 missense probably damaging 1.00
IGL00543:Acvr1c APN 2 58315823 missense probably damaging 1.00
IGL01287:Acvr1c APN 2 58280242 nonsense probably null
IGL01313:Acvr1c APN 2 58315974 missense probably benign 0.10
IGL01722:Acvr1c APN 2 58283549 splice site probably benign
R0035:Acvr1c UTSW 2 58315779 splice site probably benign
R0035:Acvr1c UTSW 2 58315779 splice site probably benign
R0329:Acvr1c UTSW 2 58284838 missense probably damaging 0.96
R0330:Acvr1c UTSW 2 58284838 missense probably damaging 0.96
R1311:Acvr1c UTSW 2 58280249 missense probably benign 0.04
R1465:Acvr1c UTSW 2 58284961 missense probably damaging 1.00
R1465:Acvr1c UTSW 2 58284961 missense probably damaging 1.00
R1511:Acvr1c UTSW 2 58287884 missense probably damaging 1.00
R1813:Acvr1c UTSW 2 58280294 missense probably damaging 1.00
R1896:Acvr1c UTSW 2 58280294 missense probably damaging 1.00
R1935:Acvr1c UTSW 2 58283505 missense probably damaging 1.00
R1939:Acvr1c UTSW 2 58283505 missense probably damaging 1.00
R1940:Acvr1c UTSW 2 58283505 missense probably damaging 1.00
R2001:Acvr1c UTSW 2 58315975 missense probably benign 0.04
R2002:Acvr1c UTSW 2 58315975 missense probably benign 0.04
R2305:Acvr1c UTSW 2 58281699 missense probably damaging 1.00
R4786:Acvr1c UTSW 2 58280354 missense probably damaging 1.00
R4947:Acvr1c UTSW 2 58315975 missense probably benign 0.04
R5121:Acvr1c UTSW 2 58281650 missense probably damaging 1.00
R5133:Acvr1c UTSW 2 58283506 missense probably damaging 1.00
R5381:Acvr1c UTSW 2 58287735 missense probably damaging 1.00
R5383:Acvr1c UTSW 2 58287735 missense probably damaging 1.00
R5647:Acvr1c UTSW 2 58295964 missense probably damaging 1.00
R5988:Acvr1c UTSW 2 58315874 missense probably damaging 1.00
R6860:Acvr1c UTSW 2 58287705 missense probably damaging 1.00
R7137:Acvr1c UTSW 2 58283387 critical splice donor site probably null
R7278:Acvr1c UTSW 2 58284936 missense probably damaging 1.00
R8029:Acvr1c UTSW 2 58296117 missense possibly damaging 0.95
R8504:Acvr1c UTSW 2 58283479 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ACTCTAGAGAATTCCACCAGCTG -3'
(R):5'- CCTCTTTCCAGGACTGAAGTG -3'

Sequencing Primer
(F):5'- TAGAGAATTCCACCAGCTGAAAACG -3'
(R):5'- CCAGGACTGAAGTGTGTGTGTC -3'
Posted On2019-06-26