Incidental Mutation 'R7200:Rnf38'
ID560228
Institutional Source Beutler Lab
Gene Symbol Rnf38
Ensembl Gene ENSMUSG00000035696
Gene Namering finger protein 38
Synonyms2610202O07Rik, Oip1, 1700065B19Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.478) question?
Stock #R7200 (G1)
Quality Score225.009
Status Not validated
Chromosome4
Chromosomal Location44126210-44233789 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 44137620 bp
ZygosityHeterozygous
Amino Acid Change Serine to Arginine at position 320 (S320R)
Ref Sequence ENSEMBL: ENSMUSP00000095702 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000045793] [ENSMUST00000098098] [ENSMUST00000102934] [ENSMUST00000107836] [ENSMUST00000128426] [ENSMUST00000136730] [ENSMUST00000143337] [ENSMUST00000145760]
Predicted Effect probably benign
Transcript: ENSMUST00000045793
AA Change: S288R

PolyPhen 2 Score 0.073 (Sensitivity: 0.93; Specificity: 0.84)
SMART Domains Protein: ENSMUSP00000038477
Gene: ENSMUSG00000035696
AA Change: S288R

DomainStartEndE-ValueType
low complexity region 32 51 N/A INTRINSIC
low complexity region 192 207 N/A INTRINSIC
low complexity region 244 258 N/A INTRINSIC
low complexity region 287 310 N/A INTRINSIC
RING 380 420 9.09e-8 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000098098
AA Change: S320R

PolyPhen 2 Score 0.008 (Sensitivity: 0.96; Specificity: 0.76)
SMART Domains Protein: ENSMUSP00000095702
Gene: ENSMUSG00000035696
AA Change: S320R

DomainStartEndE-ValueType
low complexity region 24 32 N/A INTRINSIC
low complexity region 64 83 N/A INTRINSIC
low complexity region 224 239 N/A INTRINSIC
low complexity region 276 290 N/A INTRINSIC
low complexity region 319 342 N/A INTRINSIC
RING 412 452 9.09e-8 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000102934
AA Change: S288R

PolyPhen 2 Score 0.073 (Sensitivity: 0.93; Specificity: 0.84)
SMART Domains Protein: ENSMUSP00000099998
Gene: ENSMUSG00000035696
AA Change: S288R

DomainStartEndE-ValueType
low complexity region 32 51 N/A INTRINSIC
low complexity region 192 207 N/A INTRINSIC
low complexity region 244 258 N/A INTRINSIC
low complexity region 287 310 N/A INTRINSIC
RING 380 420 9.09e-8 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000107836
AA Change: S288R

PolyPhen 2 Score 0.073 (Sensitivity: 0.93; Specificity: 0.84)
SMART Domains Protein: ENSMUSP00000103467
Gene: ENSMUSG00000035696
AA Change: S288R

DomainStartEndE-ValueType
low complexity region 32 51 N/A INTRINSIC
low complexity region 192 207 N/A INTRINSIC
low complexity region 244 258 N/A INTRINSIC
low complexity region 287 310 N/A INTRINSIC
RING 380 420 9.09e-8 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000128426
SMART Domains Protein: ENSMUSP00000119889
Gene: ENSMUSG00000035696

DomainStartEndE-ValueType
low complexity region 32 51 N/A INTRINSIC
low complexity region 192 207 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000136730
AA Change: S288R

PolyPhen 2 Score 0.029 (Sensitivity: 0.95; Specificity: 0.82)
SMART Domains Protein: ENSMUSP00000116642
Gene: ENSMUSG00000035696
AA Change: S288R

DomainStartEndE-ValueType
low complexity region 32 51 N/A INTRINSIC
low complexity region 192 207 N/A INTRINSIC
low complexity region 244 258 N/A INTRINSIC
low complexity region 287 310 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000143337
SMART Domains Protein: ENSMUSP00000122342
Gene: ENSMUSG00000035696

DomainStartEndE-ValueType
low complexity region 32 51 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000145760
SMART Domains Protein: ENSMUSP00000121329
Gene: ENSMUSG00000035696

DomainStartEndE-ValueType
low complexity region 32 51 N/A INTRINSIC
low complexity region 192 202 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.4%
  • 20x: 97.8%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein with a coiled-coil motif and a RING-H2 motif (C3H2C2) at its carboxy-terminus. The RING motif is a zinc-binding domain found in a large set of proteins playing roles in diverse cellular processes including oncogenesis, development, signal transduction, and apoptosis. Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Dec 2008]
Allele List at MGI
Other mutations in this stock
Total: 51 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700086D15Rik A G 11: 65,153,010 M75T unknown Het
2700049A03Rik T G 12: 71,140,906 N105K probably damaging Het
Acvr1c A T 2: 58,315,855 V31E probably damaging Het
Adra1d T A 2: 131,561,250 T307S probably benign Het
Akr1c14 T C 13: 4,081,051 Y248H probably benign Het
Ankub1 T C 3: 57,672,985 T84A probably benign Het
Asb3 C A 11: 30,998,348 S8* probably null Het
AU041133 G A 10: 82,151,101 G196D possibly damaging Het
B4galt7 T C 13: 55,608,342 C214R probably damaging Het
Chd3 A G 11: 69,364,095 S140P possibly damaging Het
Ciz1 T C 2: 32,364,287 L80P probably damaging Het
Col6a4 G A 9: 106,072,249 P729L possibly damaging Het
Cr2 A G 1: 195,163,249 C133R probably damaging Het
Dmgdh T C 13: 93,691,885 L178P probably damaging Het
Dock5 C A 14: 67,771,702 E1448* probably null Het
Elavl1 A G 8: 4,311,767 S2P probably benign Het
Flywch1 T C 17: 23,761,059 H247R possibly damaging Het
Gabpb1 A T 2: 126,639,302 I309N possibly damaging Het
Glrx3 T C 7: 137,464,436 F298L possibly damaging Het
Gm9573 TCCTGAGGCAGTGCTGGATACAGGGGTGGTTGGGGTGGGTGAAGAGCCTGAGGCAGTGCTGGAT TCCTGAGGCAGTGCTGGAT 17: 35,622,633 probably benign Het
Gpc6 G A 14: 117,964,856 V493I probably benign Het
H2-Bl A T 17: 36,081,046 I45N possibly damaging Het
Hadha C T 5: 30,145,317 E78K probably benign Het
Hjurp TCTGGGAGGGCTTGCTCCGGGGGCAGTGTGTCCTGTTCTTGTGCAGCCCCTGCT TCT 1: 88,266,278 probably benign Het
Ldlrad3 G T 2: 102,113,558 F56L probably damaging Het
Ldlrad3 A G 2: 102,113,560 F56L probably damaging Het
Mapk4 A T 18: 73,930,919 S411T possibly damaging Het
Mcm9 A G 10: 53,615,923 M382T Het
Olfr1457 T C 19: 13,095,232 T139A probably benign Het
Olfr720 A T 14: 14,175,477 C202S probably damaging Het
Pacs1 A C 19: 5,156,413 I248S possibly damaging Het
Pi16 C A 17: 29,319,234 P7Q possibly damaging Het
Plekhg1 T C 10: 3,956,810 S631P Het
Rars2 A T 4: 34,645,747 K221N probably benign Het
Retsat T C 6: 72,606,019 S388P possibly damaging Het
Rft1 G A 14: 30,682,857 probably null Het
Rgsl1 A G 1: 153,785,199 V345A probably benign Het
Sel1l3 T A 5: 53,144,109 Y722F probably benign Het
Slc13a4 T C 6: 35,287,350 E194G possibly damaging Het
Spata17 G A 1: 187,112,503 R300C probably benign Het
Tacc1 G A 8: 25,241,640 probably benign Het
Tc2n T G 12: 101,689,055 I214L probably damaging Het
Tet2 T C 3: 133,487,192 S494G probably benign Het
Tmco5b A T 2: 113,291,377 I179L probably damaging Het
Triobp AGGGACAATCCCAGGGCCTCCTCTCCCAACAGAACTACTCAGCGGGACAA AGGGACAA 15: 78,966,842 probably benign Het
Trpv1 A G 11: 73,239,586 T173A probably damaging Het
Vmn2r56 C T 7: 12,710,332 G458R probably damaging Het
Vmn2r81 T G 10: 79,270,736 probably null Het
Wfdc15b T A 2: 164,215,117 E80D probably benign Het
Wrn A T 8: 33,322,348 D423E probably benign Het
Zfp775 T A 6: 48,620,481 C430S possibly damaging Het
Other mutations in Rnf38
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01073:Rnf38 APN 4 44137645 missense probably benign 0.09
IGL01992:Rnf38 APN 4 44138806 missense probably damaging 1.00
IGL02682:Rnf38 APN 4 44133745 missense probably damaging 1.00
IGL02951:Rnf38 APN 4 44129619 nonsense probably null
IGL03032:Rnf38 APN 4 44152529 missense probably damaging 0.99
IGL03326:Rnf38 APN 4 44149182 missense probably benign 0.27
R0335:Rnf38 UTSW 4 44152507 missense possibly damaging 0.59
R0336:Rnf38 UTSW 4 44152350 splice site probably benign
R1473:Rnf38 UTSW 4 44131584 missense probably benign 0.00
R1552:Rnf38 UTSW 4 44142468 splice site probably null
R1670:Rnf38 UTSW 4 44138681 missense probably damaging 0.96
R1708:Rnf38 UTSW 4 44143593 missense probably damaging 1.00
R1943:Rnf38 UTSW 4 44138748 missense probably damaging 0.99
R2063:Rnf38 UTSW 4 44149098 missense probably damaging 0.99
R4348:Rnf38 UTSW 4 44149100 missense possibly damaging 0.84
R4352:Rnf38 UTSW 4 44149100 missense possibly damaging 0.84
R4353:Rnf38 UTSW 4 44149100 missense possibly damaging 0.84
R4618:Rnf38 UTSW 4 44142450 missense probably damaging 1.00
R4967:Rnf38 UTSW 4 44152460 missense probably damaging 1.00
R5230:Rnf38 UTSW 4 44149176 missense probably benign 0.17
R6275:Rnf38 UTSW 4 44152408 missense probably benign 0.11
R6855:Rnf38 UTSW 4 44149224 missense probably damaging 1.00
R7326:Rnf38 UTSW 4 44158989 intron probably benign
R7351:Rnf38 UTSW 4 44149102 missense probably benign 0.40
Predicted Primers PCR Primer
(F):5'- GACTGGCTCTCAAGTCCAAC -3'
(R):5'- TTGAGTTCCATCCCAGAGCTC -3'

Sequencing Primer
(F):5'- TGGCTCTCAAGTCCAACTTAAC -3'
(R):5'- TCACGTGCATGCCGTAACAG -3'
Posted On2019-06-26