Mutagenetix > Incidental Mutations

Incidental Mutation 'R7200:Sel1l3'

560230

Institutional Source

Beutler Lab

Gene Symbol

Sel1l3

Ensembl Gene

ENSMUSG00000029189

Gene Name

sel-1 suppressor of lin-12-like 3 (C. elegans)

Synonyms

2310045A20Rik

MMRRC Submission

Accession Numbers

Is this an essential gene?

Non essential (E-score: 0.000) question?

Stock #

R7200 (G1)

Quality Score

225.009

Status

Not validated

Chromosome

Chromosomal Location

53107083-53213927 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to A at 53144109 bp

Zygosity

Heterozygous

Amino Acid Change

Tyrosine to Phenylalanine at position 722 (Y722F)

Ref Sequence

ENSEMBL: ENSMUSP00000031090 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000031090]

Predicted Effect

probably benign
Transcript: ENSMUST00000031090
AA Change: Y722F

PolyPhen 2 Score 0.222 (Sensitivity: 0.91; Specificity: 0.88)

SMART Domains

Protein: ENSMUSP00000031090
Gene: ENSMUSG00000029189
AA Change: Y722F

Domain	Start	End	E-Value	Type
low complexity region	11	33	N/A	INTRINSIC
SEL1	575	609	3.39e1	SMART
SEL1	611	647	1.85e1	SMART
SEL1	694	730	5.27e-5	SMART
SEL1	732	767	2.94e-3	SMART
SEL1	768	800	5.32e-1	SMART
SEL1	801	839	1.23e-5	SMART
SEL1	840	877	8.55e1	SMART
SEL1	952	988	2.56e-3	SMART
low complexity region	1048	1058	N/A	INTRINSIC
transmembrane domain	1065	1087	N/A	INTRINSIC
low complexity region	1102	1127	N/A	INTRINSIC

Coding Region Coverage

1x: 100.0%
3x: 99.9%
10x: 99.4%
20x: 97.8%

Validation Efficiency

Allele List at MGI

Other mutations in this stock

Total: 51 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1700086D15Rik	A	G	11: 65,153,010	M75T	unknown	Het
2700049A03Rik	T	G	12: 71,140,906	N105K	probably damaging	Het
Acvr1c	A	T	2: 58,315,855	V31E	probably damaging	Het
Adra1d	T	A	2: 131,561,250	T307S	probably benign	Het
Akr1c14	T	C	13: 4,081,051	Y248H	probably benign	Het
Ankub1	T	C	3: 57,672,985	T84A	probably benign	Het
Asb3	C	A	11: 30,998,348	S8*	probably null	Het
AU041133	G	A	10: 82,151,101	G196D	possibly damaging	Het
B4galt7	T	C	13: 55,608,342	C214R	probably damaging	Het
Chd3	A	G	11: 69,364,095	S140P	possibly damaging	Het
Ciz1	T	C	2: 32,364,287	L80P	probably damaging	Het
Col6a4	G	A	9: 106,072,249	P729L	possibly damaging	Het
Cr2	A	G	1: 195,163,249	C133R	probably damaging	Het
Dmgdh	T	C	13: 93,691,885	L178P	probably damaging	Het
Dock5	C	A	14: 67,771,702	E1448*	probably null	Het
Elavl1	A	G	8: 4,311,767	S2P	probably benign	Het
Flywch1	T	C	17: 23,761,059	H247R	possibly damaging	Het
Gabpb1	A	T	2: 126,639,302	I309N	possibly damaging	Het
Glrx3	T	C	7: 137,464,436	F298L	possibly damaging	Het
Gm9573	TCCTGAGGCAGTGCTGGATACAGGGGTGGTTGGGGTGGGTGAAGAGCCTGAGGCAGTGCTGGAT	TCCTGAGGCAGTGCTGGAT	17: 35,622,633		probably benign	Het
Gpc6	G	A	14: 117,964,856	V493I	probably benign	Het
H2-Bl	A	T	17: 36,081,046	I45N	possibly damaging	Het
Hadha	C	T	5: 30,145,317	E78K	probably benign	Het
Hjurp	TCTGGGAGGGCTTGCTCCGGGGGCAGTGTGTCCTGTTCTTGTGCAGCCCCTGCT	TCT	1: 88,266,278		probably benign	Het
Ldlrad3	G	T	2: 102,113,558	F56L	probably damaging	Het
Ldlrad3	A	G	2: 102,113,560	F56L	probably damaging	Het
Mapk4	A	T	18: 73,930,919	S411T	possibly damaging	Het
Mcm9	A	G	10: 53,615,923	M382T		Het
Olfr1457	T	C	19: 13,095,232	T139A	probably benign	Het
Olfr720	A	T	14: 14,175,477	C202S	probably damaging	Het
Pacs1	A	C	19: 5,156,413	I248S	possibly damaging	Het
Pi16	C	A	17: 29,319,234	P7Q	possibly damaging	Het
Plekhg1	T	C	10: 3,956,810	S631P		Het
Rars2	A	T	4: 34,645,747	K221N	probably benign	Het
Retsat	T	C	6: 72,606,019	S388P	possibly damaging	Het
Rft1	G	A	14: 30,682,857		probably null	Het
Rgsl1	A	G	1: 153,785,199	V345A	probably benign	Het
Rnf38	A	T	4: 44,137,620	S320R	probably benign	Het
Slc13a4	T	C	6: 35,287,350	E194G	possibly damaging	Het
Spata17	G	A	1: 187,112,503	R300C	probably benign	Het
Tacc1	G	A	8: 25,241,640		probably benign	Het
Tc2n	T	G	12: 101,689,055	I214L	probably damaging	Het
Tet2	T	C	3: 133,487,192	S494G	probably benign	Het
Tmco5b	A	T	2: 113,291,377	I179L	probably damaging	Het
Triobp	AGGGACAATCCCAGGGCCTCCTCTCCCAACAGAACTACTCAGCGGGACAA	AGGGACAA	15: 78,966,842		probably benign	Het
Trpv1	A	G	11: 73,239,586	T173A	probably damaging	Het
Vmn2r56	C	T	7: 12,710,332	G458R	probably damaging	Het
Vmn2r81	T	G	10: 79,270,736		probably null	Het
Wfdc15b	T	A	2: 164,215,117	E80D	probably benign	Het
Wrn	A	T	8: 33,322,348	D423E	probably benign	Het
Zfp775	T	A	6: 48,620,481	C430S	possibly damaging	Het

Other mutations in Sel1l3

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01152:Sel1l3	APN	5	53116333	missense	probably damaging	0.96
IGL01585:Sel1l3	APN	5	53154236	missense	probably damaging	0.99
IGL01717:Sel1l3	APN	5	53200168	missense	probably damaging	0.99
IGL01771:Sel1l3	APN	5	53121841	missense	probably damaging	0.99
IGL01926:Sel1l3	APN	5	53200143	missense	probably benign	0.26
IGL01963:Sel1l3	APN	5	53200338	missense	probably damaging	0.99
IGL02000:Sel1l3	APN	5	53145493	missense	probably damaging	1.00
IGL02132:Sel1l3	APN	5	53170405	missense	possibly damaging	0.89
IGL02198:Sel1l3	APN	5	53139799	splice site	probably benign
IGL02930:Sel1l3	APN	5	53123217	missense	possibly damaging	0.65
IGL03146:Sel1l3	APN	5	53154243	missense	probably benign	0.00
IGL03175:Sel1l3	APN	5	53121857	missense	probably damaging	1.00
R0083:Sel1l3	UTSW	5	53137902	missense	possibly damaging	0.79
R0108:Sel1l3	UTSW	5	53137902	missense	possibly damaging	0.79
R0108:Sel1l3	UTSW	5	53137902	missense	possibly damaging	0.79
R0940:Sel1l3	UTSW	5	53144037	splice site	probably benign
R1027:Sel1l3	UTSW	5	53145478	missense	possibly damaging	0.68
R1117:Sel1l3	UTSW	5	53172607	missense	probably benign	0.00
R1145:Sel1l3	UTSW	5	53131827	missense	probably damaging	0.99
R1145:Sel1l3	UTSW	5	53131827	missense	probably damaging	0.99
R1146:Sel1l3	UTSW	5	53117103	missense	possibly damaging	0.79
R1146:Sel1l3	UTSW	5	53117103	missense	possibly damaging	0.79
R1345:Sel1l3	UTSW	5	53200217	missense	possibly damaging	0.86
R1370:Sel1l3	UTSW	5	53200217	missense	possibly damaging	0.86
R1503:Sel1l3	UTSW	5	53137929	missense	probably damaging	0.98
R1747:Sel1l3	UTSW	5	53145545	missense	possibly damaging	0.91
R1764:Sel1l3	UTSW	5	53170447	nonsense	probably null
R2872:Sel1l3	UTSW	5	53137883	nonsense	probably null
R2872:Sel1l3	UTSW	5	53137883	nonsense	probably null
R3434:Sel1l3	UTSW	5	53117090	missense	probably benign	0.44
R4043:Sel1l3	UTSW	5	53188054	nonsense	probably null
R4074:Sel1l3	UTSW	5	53154287	missense	probably damaging	0.99
R4727:Sel1l3	UTSW	5	53144183	critical splice acceptor site	probably null
R4788:Sel1l3	UTSW	5	53131833	missense	probably benign	0.41
R4900:Sel1l3	UTSW	5	53131842	missense	probably damaging	1.00
R5000:Sel1l3	UTSW	5	53200434	missense	probably damaging	0.97
R5090:Sel1l3	UTSW	5	53200046	missense	probably benign	0.03
R5330:Sel1l3	UTSW	5	53186009	missense	possibly damaging	0.80
R5456:Sel1l3	UTSW	5	53200036	missense	probably benign	0.13
R5544:Sel1l3	UTSW	5	53200302	missense	probably damaging	0.98
R5848:Sel1l3	UTSW	5	53184808	missense	possibly damaging	0.91
R6132:Sel1l3	UTSW	5	53200189	missense	possibly damaging	0.77
R6188:Sel1l3	UTSW	5	53155719	missense	possibly damaging	0.70
R6622:Sel1l3	UTSW	5	53139860	missense	probably damaging	0.98
R7015:Sel1l3	UTSW	5	53172574	missense	probably benign	0.03
R7271:Sel1l3	UTSW	5	53116362	missense	probably damaging	0.98
R7378:Sel1l3	UTSW	5	53116409	missense	probably benign	0.02
R7479:Sel1l3	UTSW	5	53117120	missense	probably damaging	0.99
R7563:Sel1l3	UTSW	5	53185984	missense	probably damaging	1.00
R7643:Sel1l3	UTSW	5	53123162	splice site	probably null
R7741:Sel1l3	UTSW	5	53200251	missense	probably damaging	1.00
R7743:Sel1l3	UTSW	5	53135885	missense	probably benign	0.07
R7861:Sel1l3	UTSW	5	53144064	missense	probably damaging	0.96
R7904:Sel1l3	UTSW	5	53139824	missense	probably benign	0.24
R8222:Sel1l3	UTSW	5	53187954	critical splice donor site	probably null
Z1088:Sel1l3	UTSW	5	53116196	missense	probably damaging	0.96

Predicted Primers

PCR Primer
(F):5'- AGCCGCTTGTTCTAAGACTTTCTG -3'
(R):5'- CCAGAGTGGCAGGTGTAGTGA -3'

Sequencing Primer
(F):5'- AAGACTTTCTGTTTGCCTGCACG -3'
(R):5'- AACAGTCATGCTATGCCTGG -3'

Posted On

2019-06-26