Incidental Mutation 'R7200:Glrx3'
ID560235
Institutional Source Beutler Lab
Gene Symbol Glrx3
Ensembl Gene ENSMUSG00000031068
Gene Nameglutaredoxin 3
SynonymsPKC interacting cousin of thioredoxin, Txnl2, PICOT
MMRRC Submission
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R7200 (G1)
Quality Score225.009
Status Not validated
Chromosome7
Chromosomal Location137437614-137468594 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 137464436 bp
ZygosityHeterozygous
Amino Acid Change Phenylalanine to Leucine at position 298 (F298L)
Ref Sequence ENSEMBL: ENSMUSP00000147803 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000064404] [ENSMUST00000209696] [ENSMUST00000211496] [ENSMUST00000211769]
Predicted Effect probably benign
Transcript: ENSMUST00000064404
AA Change: F298L

PolyPhen 2 Score 0.047 (Sensitivity: 0.94; Specificity: 0.83)
SMART Domains Protein: ENSMUSP00000066621
Gene: ENSMUSG00000031068
AA Change: F298L

DomainStartEndE-ValueType
Pfam:Phosducin 6 102 6.3e-10 PFAM
Pfam:DIM1 13 112 4.5e-9 PFAM
Pfam:Thioredoxin 15 117 1.2e-21 PFAM
Pfam:Glutaredoxin 148 212 2.9e-19 PFAM
Pfam:Glutaredoxin 250 314 1.5e-19 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000209696
Predicted Effect possibly damaging
Transcript: ENSMUST00000211496
AA Change: F298L

PolyPhen 2 Score 0.807 (Sensitivity: 0.84; Specificity: 0.93)
Predicted Effect probably benign
Transcript: ENSMUST00000211769
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.4%
  • 20x: 97.8%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the glutaredoxin family. Glutaredoxins are oxidoreductase enzymes that reduce a variety of substrates using glutathione as a cofactor. The encoded protein binds to and modulates the function of protein kinase C theta. The encoded protein may also inhibit apoptosis and play a role in cellular growth, and the expression of this gene may be a marker for cancer. Pseudogenes of this gene are located on the short arm of chromosomes 6 and 9. Alternatively spliced transcript variants have been observed for this gene. [provided by RefSeq, Dec 2010]
PHENOTYPE: Mice homozygous for a gene trapped allele exhibit lethality during late organogenesis and early fetal development. Mice heterozygous for this gene trapped allele exhibit increased response to cardiac injury and decreased cardiac muscle contractility. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 51 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700086D15Rik A G 11: 65,153,010 M75T unknown Het
2700049A03Rik T G 12: 71,140,906 N105K probably damaging Het
Acvr1c A T 2: 58,315,855 V31E probably damaging Het
Adra1d T A 2: 131,561,250 T307S probably benign Het
Akr1c14 T C 13: 4,081,051 Y248H probably benign Het
Ankub1 T C 3: 57,672,985 T84A probably benign Het
Asb3 C A 11: 30,998,348 S8* probably null Het
AU041133 G A 10: 82,151,101 G196D possibly damaging Het
B4galt7 T C 13: 55,608,342 C214R probably damaging Het
Chd3 A G 11: 69,364,095 S140P possibly damaging Het
Ciz1 T C 2: 32,364,287 L80P probably damaging Het
Col6a4 G A 9: 106,072,249 P729L possibly damaging Het
Cr2 A G 1: 195,163,249 C133R probably damaging Het
Dmgdh T C 13: 93,691,885 L178P probably damaging Het
Dock5 C A 14: 67,771,702 E1448* probably null Het
Elavl1 A G 8: 4,311,767 S2P probably benign Het
Flywch1 T C 17: 23,761,059 H247R possibly damaging Het
Gabpb1 A T 2: 126,639,302 I309N possibly damaging Het
Gm9573 TCCTGAGGCAGTGCTGGATACAGGGGTGGTTGGGGTGGGTGAAGAGCCTGAGGCAGTGCTGGAT TCCTGAGGCAGTGCTGGAT 17: 35,622,633 probably benign Het
Gpc6 G A 14: 117,964,856 V493I probably benign Het
H2-Bl A T 17: 36,081,046 I45N possibly damaging Het
Hadha C T 5: 30,145,317 E78K probably benign Het
Hjurp TCTGGGAGGGCTTGCTCCGGGGGCAGTGTGTCCTGTTCTTGTGCAGCCCCTGCT TCT 1: 88,266,278 probably benign Het
Ldlrad3 G T 2: 102,113,558 F56L probably damaging Het
Ldlrad3 A G 2: 102,113,560 F56L probably damaging Het
Mapk4 A T 18: 73,930,919 S411T possibly damaging Het
Mcm9 A G 10: 53,615,923 M382T Het
Olfr1457 T C 19: 13,095,232 T139A probably benign Het
Olfr720 A T 14: 14,175,477 C202S probably damaging Het
Pacs1 A C 19: 5,156,413 I248S possibly damaging Het
Pi16 C A 17: 29,319,234 P7Q possibly damaging Het
Plekhg1 T C 10: 3,956,810 S631P Het
Rars2 A T 4: 34,645,747 K221N probably benign Het
Retsat T C 6: 72,606,019 S388P possibly damaging Het
Rft1 G A 14: 30,682,857 probably null Het
Rgsl1 A G 1: 153,785,199 V345A probably benign Het
Rnf38 A T 4: 44,137,620 S320R probably benign Het
Sel1l3 T A 5: 53,144,109 Y722F probably benign Het
Slc13a4 T C 6: 35,287,350 E194G possibly damaging Het
Spata17 G A 1: 187,112,503 R300C probably benign Het
Tacc1 G A 8: 25,241,640 probably benign Het
Tc2n T G 12: 101,689,055 I214L probably damaging Het
Tet2 T C 3: 133,487,192 S494G probably benign Het
Tmco5b A T 2: 113,291,377 I179L probably damaging Het
Triobp AGGGACAATCCCAGGGCCTCCTCTCCCAACAGAACTACTCAGCGGGACAA AGGGACAA 15: 78,966,842 probably benign Het
Trpv1 A G 11: 73,239,586 T173A probably damaging Het
Vmn2r56 C T 7: 12,710,332 G458R probably damaging Het
Vmn2r81 T G 10: 79,270,736 probably null Het
Wfdc15b T A 2: 164,215,117 E80D probably benign Het
Wrn A T 8: 33,322,348 D423E probably benign Het
Zfp775 T A 6: 48,620,481 C430S possibly damaging Het
Other mutations in Glrx3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00678:Glrx3 APN 7 137452713 missense probably damaging 1.00
IGL02435:Glrx3 APN 7 137461396 missense possibly damaging 0.61
F5770:Glrx3 UTSW 7 137459153 missense probably benign
R0347:Glrx3 UTSW 7 137437701 missense unknown
R0359:Glrx3 UTSW 7 137453485 missense possibly damaging 0.80
R1270:Glrx3 UTSW 7 137453414 missense probably benign 0.02
R3692:Glrx3 UTSW 7 137459117 splice site probably benign
R4909:Glrx3 UTSW 7 137445036 missense probably damaging 1.00
R4920:Glrx3 UTSW 7 137464130 missense probably null 1.00
R5509:Glrx3 UTSW 7 137445022 missense probably damaging 1.00
R6831:Glrx3 UTSW 7 137459222 missense possibly damaging 0.76
R7347:Glrx3 UTSW 7 137459286 missense possibly damaging 0.83
R7356:Glrx3 UTSW 7 137452724 missense probably damaging 0.98
R7481:Glrx3 UTSW 7 137445022 missense probably damaging 1.00
R7660:Glrx3 UTSW 7 137459225 missense probably damaging 1.00
R7685:Glrx3 UTSW 7 137459191 missense probably damaging 0.98
R8147:Glrx3 UTSW 7 137463007 missense probably benign 0.00
V7581:Glrx3 UTSW 7 137459153 missense probably benign
Predicted Primers PCR Primer
(F):5'- AAAATGCTTTCTCCTTTTGCAGGG -3'
(R):5'- TACACTGACAGGCTGGAGAG -3'

Sequencing Primer
(F):5'- ACACTTTGTAGACCAGGCTG -3'
(R):5'- AGAGGAGGAGCCCCACAC -3'
Posted On2019-06-26