Mutagenetix > Incidental Mutations

Incidental Mutation 'R0592:Numa1'

56024

Institutional Source

Beutler Lab

Gene Symbol

Numa1

Ensembl Gene

ENSMUSG00000066306

Gene Name

nuclear mitotic apparatus protein 1

Synonyms

6720401E04Rik

MMRRC Submission

038782-MU

Accession Numbers

Genbank: NM_133947.3; Ensembl: ENSMUST00000084852

Is this an essential gene?

Essential (E-score: 1.000) question?

Stock #

R0592 (G1)

Quality Score

206

Status

Validated

Chromosome

Chromosomal Location

101934111-102014964 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 102013897 bp

Zygosity

Heterozygous

Amino Acid Change

Threonine to Alanine at position 724 (T724A)

Ref Sequence

ENSEMBL: ENSMUSP00000126180 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000084852] [ENSMUST00000094134] [ENSMUST00000163183] [ENSMUST00000209368] [ENSMUST00000209844] [ENSMUST00000211502]

Predicted Effect

probably benign
Transcript: ENSMUST00000084852
AA Change: T2077A

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)

SMART Domains

Protein: ENSMUSP00000081912
Gene: ENSMUSG00000066306
AA Change: T2077A

Domain	Start	End	E-Value	Type
low complexity region	187	201	N/A	INTRINSIC
coiled coil region	211	249	N/A	INTRINSIC
coiled coil region	274	818	N/A	INTRINSIC
low complexity region	856	869	N/A	INTRINSIC
internal_repeat_1	910	933	6.03e-6	PROSPERO
internal_repeat_2	911	951	2.35e-5	PROSPERO
low complexity region	979	992	N/A	INTRINSIC
low complexity region	1002	1018	N/A	INTRINSIC
low complexity region	1063	1081	N/A	INTRINSIC
internal_repeat_5	1094	1116	4.63e-5	PROSPERO
low complexity region	1130	1138	N/A	INTRINSIC
low complexity region	1220	1233	N/A	INTRINSIC
low complexity region	1271	1289	N/A	INTRINSIC
low complexity region	1364	1374	N/A	INTRINSIC
coiled coil region	1464	1681	N/A	INTRINSIC
low complexity region	1700	1711	N/A	INTRINSIC
internal_repeat_3	1718	1755	4.63e-5	PROSPERO
internal_repeat_4	1777	1819	4.63e-5	PROSPERO
internal_repeat_3	1800	1842	4.63e-5	PROSPERO
internal_repeat_4	1811	1854	4.63e-5	PROSPERO
low complexity region	1859	1875	N/A	INTRINSIC
PDB:3RO2\|B	1881	1908	3e-13	PDB
internal_repeat_2	1938	1977	2.35e-5	PROSPERO
internal_repeat_5	1973	1995	4.63e-5	PROSPERO
internal_repeat_1	2020	2043	6.03e-6	PROSPERO
low complexity region	2073	2085	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000094134

SMART Domains

Protein: ENSMUSP00000091685
Gene: ENSMUSG00000070427

Domain	Start	End	E-Value	Type
signal peptide	1	26	N/A	INTRINSIC
Blast:IG	66	170	7e-54	BLAST
PDB:4EKX\|A	71	167	6e-6	PDB

Predicted Effect

probably benign
Transcript: ENSMUST00000163183
AA Change: T724A

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)

SMART Domains

Protein: ENSMUSP00000126180
Gene: ENSMUSG00000066306
AA Change: T724A

Domain	Start	End	E-Value	Type
coiled coil region	7	73	N/A	INTRINSIC
low complexity region	150	160	N/A	INTRINSIC
SCOP:d1fxkc_	164	290	7e-3	SMART
low complexity region	347	358	N/A	INTRINSIC
low complexity region	506	522	N/A	INTRINSIC
PDB:3RO2\|B	528	555	2e-10	PDB
low complexity region	720	732	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000209368

Predicted Effect

probably benign
Transcript: ENSMUST00000209844

Predicted Effect

probably benign
Transcript: ENSMUST00000211502

Meta Mutation Damage Score

0.0898

Coding Region Coverage

1x: 99.4%
3x: 98.9%
10x: 97.5%
20x: 95.0%

Validation Efficiency

100% (35/35)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a large protein that forms a structural component of the nuclear matrix. The encoded protein interacts with microtubules and plays a role in the formation and organization of the mitotic spindle during cell division. Chromosomal translocation of this gene with the RARA (retinoic acid receptor, alpha) gene on chromosome 17 have been detected in patients with acute promyelocytic leukemia. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Nov 2013]
PHENOTYPE: Mice homozygous for a knock-out or hypomorphic allele exhibit embryonic lethality by E9.5. [provided by MGI curators]

Allele List at MGI

All alleles(97) : Targeted, knock-out(1) Targeted, other(2) Gene trapped(94)

Other mutations in this stock

Total: 35 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Atg2a	GCCTTCCTTCCTTCCTTCCTTCCTTCCTTCCTTCC	GCCTTCCTTCCTTCCTTCCTTCCTTCCTTCCTTCCTTCC	19: 6,245,007		probably benign	Het
Bbs7	A	T	3: 36,610,297	V53D	probably benign	Het
Bglap	T	A	3: 88,383,655	I90F	probably benign	Het
C2cd4b	G	A	9: 67,760,691	R323H	probably damaging	Het
Cdh5	T	A	8: 104,130,902		probably null	Het
Cdh8	T	A	8: 99,279,478	D159V	probably damaging	Het
Dnah7a	A	G	1: 53,456,612	Y3229H	possibly damaging	Het
Dzip1	T	C	14: 118,902,139	E381G	probably damaging	Het
Elmod1	A	G	9: 53,926,106		probably benign	Het
Exosc10	T	C	4: 148,581,113	S811P	probably benign	Het
Fhl3	A	G	4: 124,705,677	Y15C	probably benign	Het
Gstz1	G	A	12: 87,163,721	S126N	probably benign	Het
Hey2	C	A	10: 30,833,957	A267S	probably benign	Het
Iqce	A	T	5: 140,686,107		probably null	Het
Katnal2	A	T	18: 77,002,560		probably null	Het
Kdm2b	G	A	5: 122,961,134		probably benign	Het
Mov10l1	A	G	15: 88,998,766		probably null	Het
Oas3	A	G	5: 120,771,149	F244S	probably damaging	Het
Olfr1472	T	C	19: 13,453,705	I271V	probably benign	Het
Olfr715	G	A	7: 107,129,343	L17F	probably benign	Het
Ppil2	A	G	16: 17,107,219	S30P	probably benign	Het
Rab37	T	G	11: 115,160,523		probably benign	Het
Riox2	T	C	16: 59,489,579		probably benign	Het
Ryr3	A	G	2: 112,678,481	S3358P	probably damaging	Het
Sash1	T	A	10: 8,729,782	H948L	probably benign	Het
Serpinb6e	T	A	13: 33,841,074	N78I	probably damaging	Het
Slc25a47	G	A	12: 108,854,258	V63M	probably damaging	Het
Slc9b1	A	T	3: 135,394,074		probably benign	Het
Strip2	T	A	6: 29,931,210	S387T	probably benign	Het
Tcaf3	T	C	6: 42,596,843	N145S	probably benign	Het
Tex10	C	T	4: 48,456,800	R637Q	probably benign	Het
Trmu	T	C	15: 85,896,826		probably benign	Het
Vezf1	A	T	11: 88,068,435		probably benign	Het
Vmn2r116	C	T	17: 23,386,915	T267I	probably damaging	Het
Whrn	C	A	4: 63,415,567	A450S	probably damaging	Het

Other mutations in Numa1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00509:Numa1	APN	7	102013286	missense	possibly damaging	0.95
IGL00819:Numa1	APN	7	101992710	missense	possibly damaging	0.90
IGL01103:Numa1	APN	7	102001571	missense	probably benign	0.01
IGL01153:Numa1	APN	7	101994744	missense	probably damaging	1.00
IGL01954:Numa1	APN	7	101996093	nonsense	probably null
IGL02114:Numa1	APN	7	102011876	unclassified	probably benign
IGL02245:Numa1	APN	7	102000394	missense	probably benign	0.02
IGL02259:Numa1	APN	7	101987748	missense	possibly damaging	0.93
IGL02313:Numa1	APN	7	102000232	nonsense	probably null
IGL02316:Numa1	APN	7	102001370	missense	probably damaging	1.00
IGL02386:Numa1	APN	7	102007532	missense	probably benign	0.00
IGL02517:Numa1	APN	7	102012009	missense	probably benign	0.01
IGL02529:Numa1	APN	7	101999953	splice site	probably null
IGL02664:Numa1	APN	7	101998902	missense	possibly damaging	0.83
IGL02721:Numa1	APN	7	101999911	missense	probably benign	0.01
IGL02816:Numa1	APN	7	101996100	missense	probably damaging	1.00
IGL03126:Numa1	APN	7	102000667	nonsense	probably null
meltdown	UTSW	7	101990571	critical splice acceptor site	probably null
1mM(1):Numa1	UTSW	7	101994715	missense	probably benign	0.06
PIT4651001:Numa1	UTSW	7	102013934	missense	probably damaging	0.97
R0047:Numa1	UTSW	7	102009453	missense	probably damaging	1.00
R0047:Numa1	UTSW	7	102009453	missense	probably damaging	1.00
R0548:Numa1	UTSW	7	101995524	missense	possibly damaging	0.86
R0554:Numa1	UTSW	7	101995524	missense	possibly damaging	0.86
R0669:Numa1	UTSW	7	101999677	missense	probably benign
R0856:Numa1	UTSW	7	101998948	missense	probably damaging	1.00
R1072:Numa1	UTSW	7	102001150	splice site	probably null
R1776:Numa1	UTSW	7	102011050	missense	probably damaging	1.00
R1898:Numa1	UTSW	7	101992720	critical splice donor site	probably null
R1969:Numa1	UTSW	7	102009322	missense	probably damaging	0.98
R1970:Numa1	UTSW	7	102009322	missense	probably damaging	0.98
R1971:Numa1	UTSW	7	102009322	missense	probably damaging	0.98
R2180:Numa1	UTSW	7	101999990	missense	probably benign	0.00
R2256:Numa1	UTSW	7	102000791	missense	probably damaging	0.99
R2257:Numa1	UTSW	7	102000791	missense	probably damaging	0.99
R2508:Numa1	UTSW	7	101995524	missense	possibly damaging	0.86
R2958:Numa1	UTSW	7	102009495	missense	possibly damaging	0.92
R4210:Numa1	UTSW	7	102009738	missense	probably damaging	1.00
R4211:Numa1	UTSW	7	102009738	missense	probably damaging	1.00
R4643:Numa1	UTSW	7	102000665	splice site	probably null
R4783:Numa1	UTSW	7	102013566	missense	probably damaging	1.00
R4823:Numa1	UTSW	7	101996037	missense	probably damaging	1.00
R4908:Numa1	UTSW	7	102012805	missense	probably damaging	1.00
R4934:Numa1	UTSW	7	102010857	missense	probably benign	0.32
R4981:Numa1	UTSW	7	101992674	missense	probably damaging	1.00
R5120:Numa1	UTSW	7	101977437	missense	probably damaging	0.99
R5122:Numa1	UTSW	7	102013769	missense	probably damaging	1.00
R5210:Numa1	UTSW	7	101999981	missense	probably benign	0.03
R5230:Numa1	UTSW	7	101995524	missense	possibly damaging	0.86
R5547:Numa1	UTSW	7	102013930	missense	probably damaging	1.00
R5861:Numa1	UTSW	7	102009287	splice site	probably null
R6006:Numa1	UTSW	7	101992719	critical splice donor site	probably null
R6031:Numa1	UTSW	7	102012012	missense	possibly damaging	0.86
R6031:Numa1	UTSW	7	102012012	missense	possibly damaging	0.86
R6295:Numa1	UTSW	7	102000767	missense	probably benign	0.03
R6322:Numa1	UTSW	7	102000920	missense	probably damaging	1.00
R6413:Numa1	UTSW	7	101990571	critical splice acceptor site	probably null
R6786:Numa1	UTSW	7	101992638	missense	probably benign	0.05
R7218:Numa1	UTSW	7	102000910	missense	probably benign	0.02
R7312:Numa1	UTSW	7	101990599	missense	possibly damaging	0.92
R7374:Numa1	UTSW	7	102009128	missense	probably benign	0.00
R7626:Numa1	UTSW	7	101999423	missense	probably benign	0.42
R7769:Numa1	UTSW	7	101999000	missense	possibly damaging	0.77
R7830:Numa1	UTSW	7	101999285	missense	probably benign	0.03
R7886:Numa1	UTSW	7	102013865	missense	probably benign	0.27
R7935:Numa1	UTSW	7	102002331	missense	probably damaging	0.96
R8134:Numa1	UTSW	7	102001627	missense	probably benign	0.14
R8143:Numa1	UTSW	7	101999684	missense	possibly damaging	0.82
R8217:Numa1	UTSW	7	101992669	missense	possibly damaging	0.66
R8263:Numa1	UTSW	7	101999284	missense	probably benign	0.03
RF013:Numa1	UTSW	7	101999780	missense	probably damaging	0.99
Z1088:Numa1	UTSW	7	101998331	missense	probably damaging	0.99
Z1088:Numa1	UTSW	7	101998402	missense	probably benign	0.27

Predicted Primers

PCR Primer
(F):5'- AGTAGCAGTCTGACAGACCTTCCC -3'
(R):5'- AGTTATGAGTTGCCAGCCACACC -3'

Sequencing Primer
(F):5'- GTCTGACAGACCTTCCCCATAG -3'
(R):5'- CACACCTAAGAAATGTGGGGTC -3'

Posted On

2013-07-11