Mutagenetix > Incidental Mutation

Incidental Mutation 'R7200:2700049A03Rik'

560248

Institutional Source

Beutler Lab

Gene Symbol

2700049A03Rik

Ensembl Gene

ENSMUSG00000034601

Gene Name

RIKEN cDNA 2700049A03 gene

Synonyms

talpid3, Ta3

MMRRC Submission

045278-MU

Accession Numbers

Essential gene?

Essential (E-score: 1.000) question?

Stock #

R7200 (G1)

Quality Score

225.009

Status

Not validated

Chromosome

Chromosomal Location

71183622-71290077 bp(+) (GRCm39)

Type of Mutation

missense

DNA Base Change (assembly)

T to G at 71187680 bp (GRCm39)

Zygosity

Heterozygous

Amino Acid Change

Asparagine to Lysine at position 105 (N105K)

Ref Sequence

ENSEMBL: ENSMUSP00000118956 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000021486] [ENSMUST00000045907] [ENSMUST00000149564] [ENSMUST00000166120] [ENSMUST00000220482] [ENSMUST00000221178] [ENSMUST00000221367] [ENSMUST00000221559] [ENSMUST00000221797] [ENSMUST00000221815] [ENSMUST00000221892]

AlphaFold

E9PV87

Predicted Effect

probably benign
Transcript: ENSMUST00000021486

SMART Domains

Protein: ENSMUSP00000021486
Gene: ENSMUSG00000021079

Domain	Start	End	E-Value	Type
Pfam:zf-Tim10_DDP	6	70	1.3e-18	PFAM

Predicted Effect

possibly damaging
Transcript: ENSMUST00000045907
AA Change: N105K

PolyPhen 2 Score 0.719 (Sensitivity: 0.86; Specificity: 0.92)

SMART Domains

Protein: ENSMUSP00000044701
Gene: ENSMUSG00000034601
AA Change: N105K

Domain	Start	End	E-Value	Type
Pfam:TALPID3	116	1351	N/A	PFAM

Predicted Effect

probably damaging
Transcript: ENSMUST00000149564
AA Change: N105K

PolyPhen 2 Score 0.959 (Sensitivity: 0.78; Specificity: 0.95)

SMART Domains

Protein: ENSMUSP00000118956
Gene: ENSMUSG00000034601
AA Change: N105K

Domain	Start	End	E-Value	Type
Pfam:TALPID3	116	1349	N/A	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000166120

SMART Domains

Protein: ENSMUSP00000126298
Gene: ENSMUSG00000021079

Domain	Start	End	E-Value	Type
Pfam:zf-Tim10_DDP	8	69	1e-17	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000220482

Predicted Effect

probably benign
Transcript: ENSMUST00000221178

Predicted Effect

probably benign
Transcript: ENSMUST00000221367

Predicted Effect

probably benign
Transcript: ENSMUST00000221559

Predicted Effect

probably benign
Transcript: ENSMUST00000221797

Predicted Effect

probably benign
Transcript: ENSMUST00000221815

Predicted Effect

probably benign
Transcript: ENSMUST00000221892

Coding Region Coverage

1x: 100.0%
3x: 99.9%
10x: 99.4%
20x: 97.8%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a conserved centrosomal protein that functions in ciliogenesis and responds to hedgehog signaling. Mutations in this gene causes Joubert syndrome 23. Alternative splicing results in multiple transcript variants and protein isoforms. [provided by RefSeq, Aug 2016]
PHENOTYPE: Mice homozygous for a null allele die during organogenesis, lack cilia, and show randomized L-R patterning, face and neural tube defects, pericardial edema and hemorrhages. Mouse embryonic fibroblasts homozygous for a different null allele lack cilia and asymmetrical centriolar localization. [provided by MGI curators]

Allele List at MGI

All alleles(12) : Targeted, other(2) Gene trapped(10)

Other mutations in this stock

Total: 51 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1700086D15Rik	A	G	11: 65,043,836 (GRCm39)	M75T	unknown	Het
Acvr1c	A	T	2: 58,205,867 (GRCm39)	V31E	probably damaging	Het
Adra1d	T	A	2: 131,403,170 (GRCm39)	T307S	probably benign	Het
Akr1c14	T	C	13: 4,131,051 (GRCm39)	Y248H	probably benign	Het
Ankub1	T	C	3: 57,580,406 (GRCm39)	T84A	probably benign	Het
Asb3	C	A	11: 30,948,348 (GRCm39)	S8*	probably null	Het
AU041133	G	A	10: 81,986,935 (GRCm39)	G196D	possibly damaging	Het
B4galt7	T	C	13: 55,756,155 (GRCm39)	C214R	probably damaging	Het
Chd3	A	G	11: 69,254,921 (GRCm39)	S140P	possibly damaging	Het
Ciz1	T	C	2: 32,254,299 (GRCm39)	L80P	probably damaging	Het
Col6a4	G	A	9: 105,949,448 (GRCm39)	P729L	possibly damaging	Het
Cr2	A	G	1: 194,845,557 (GRCm39)	C133R	probably damaging	Het
Dmgdh	T	C	13: 93,828,393 (GRCm39)	L178P	probably damaging	Het
Dock5	C	A	14: 68,009,151 (GRCm39)	E1448*	probably null	Het
Elavl1	A	G	8: 4,361,767 (GRCm39)	S2P	probably benign	Het
Flywch1	T	C	17: 23,980,033 (GRCm39)	H247R	possibly damaging	Het
Gabpb1	A	T	2: 126,481,222 (GRCm39)	I309N	possibly damaging	Het
Glrx3	T	C	7: 137,066,165 (GRCm39)	F298L	possibly damaging	Het
Gpc6	G	A	14: 118,202,268 (GRCm39)	V493I	probably benign	Het
H2-T13	A	T	17: 36,391,938 (GRCm39)	I45N	possibly damaging	Het
Hadha	C	T	5: 30,350,315 (GRCm39)	E78K	probably benign	Het
Hjurp	TCTGGGAGGGCTTGCTCCGGGGGCAGTGTGTCCTGTTCTTGTGCAGCCCCTGCT	TCT	1: 88,194,000 (GRCm39)		probably benign	Het
Ldlrad3	G	T	2: 101,943,903 (GRCm39)	F56L	probably damaging	Het
Ldlrad3	A	G	2: 101,943,905 (GRCm39)	F56L	probably damaging	Het
Mapk4	A	T	18: 74,063,990 (GRCm39)	S411T	possibly damaging	Het
Mcm9	A	G	10: 53,492,019 (GRCm39)	M382T		Het
Muc21	TCCTGAGGCAGTGCTGGATACAGGGGTGGTTGGGGTGGGTGAAGAGCCTGAGGCAGTGCTGGAT	TCCTGAGGCAGTGCTGGAT	17: 35,933,525 (GRCm39)		probably benign	Het
Or2t6	A	T	14: 14,175,477 (GRCm38)	C202S	probably damaging	Het
Or5b104	T	C	19: 13,072,596 (GRCm39)	T139A	probably benign	Het
Pacs1	A	C	19: 5,206,441 (GRCm39)	I248S	possibly damaging	Het
Pi16	C	A	17: 29,538,208 (GRCm39)	P7Q	possibly damaging	Het
Plekhg1	T	C	10: 3,906,810 (GRCm39)	S631P		Het
Rars2	A	T	4: 34,645,747 (GRCm39)	K221N	probably benign	Het
Retsat	T	C	6: 72,583,002 (GRCm39)	S388P	possibly damaging	Het
Rft1	G	A	14: 30,404,814 (GRCm39)		probably null	Het
Rgsl1	A	G	1: 153,660,945 (GRCm39)	V345A	probably benign	Het
Rnf38	A	T	4: 44,137,620 (GRCm39)	S320R	probably benign	Het
Sel1l3	T	A	5: 53,301,451 (GRCm39)	Y722F	probably benign	Het
Slc13a4	T	C	6: 35,264,285 (GRCm39)	E194G	possibly damaging	Het
Spata17	G	A	1: 186,844,700 (GRCm39)	R300C	probably benign	Het
Tacc1	G	A	8: 25,731,656 (GRCm39)		probably benign	Het
Tc2n	T	G	12: 101,655,314 (GRCm39)	I214L	probably damaging	Het
Tet2	T	C	3: 133,192,953 (GRCm39)	S494G	probably benign	Het
Tmco5b	A	T	2: 113,121,722 (GRCm39)	I179L	probably damaging	Het
Triobp	AGGGACAATCCCAGGGCCTCCTCTCCCAACAGAACTACTCAGCGGGACAA	AGGGACAA	15: 78,851,042 (GRCm39)		probably benign	Het
Trpv1	A	G	11: 73,130,412 (GRCm39)	T173A	probably damaging	Het
Vmn2r56	C	T	7: 12,444,259 (GRCm39)	G458R	probably damaging	Het
Vmn2r81	T	G	10: 79,106,570 (GRCm39)		probably null	Het
Wfdc15b	T	A	2: 164,057,037 (GRCm39)	E80D	probably benign	Het
Wrn	A	T	8: 33,812,376 (GRCm39)	D423E	probably benign	Het
Zfp775	T	A	6: 48,597,415 (GRCm39)	C430S	possibly damaging	Het

Other mutations in 2700049A03Rik

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00339:2700049A03Rik	APN	12	71,213,893 (GRCm39)	missense	probably benign	0.00
IGL01107:2700049A03Rik	APN	12	71,241,242 (GRCm39)	critical splice donor site	probably null
IGL01404:2700049A03Rik	APN	12	71,211,152 (GRCm39)	splice site	probably null
IGL01835:2700049A03Rik	APN	12	71,213,957 (GRCm39)	missense	probably benign	0.00
IGL01835:2700049A03Rik	APN	12	71,213,955 (GRCm39)	nonsense	probably null
IGL02122:2700049A03Rik	APN	12	71,217,299 (GRCm39)	missense	possibly damaging	0.93
IGL02140:2700049A03Rik	APN	12	71,195,034 (GRCm39)	missense	probably benign	0.06
IGL02385:2700049A03Rik	APN	12	71,201,630 (GRCm39)	missense	probably damaging	0.98
IGL03181:2700049A03Rik	APN	12	71,240,147 (GRCm39)	missense	possibly damaging	0.51
IGL03253:2700049A03Rik	APN	12	71,187,657 (GRCm39)	missense	probably benign	0.33
IGL03278:2700049A03Rik	APN	12	71,205,599 (GRCm39)	splice site	probably benign
G4846:2700049A03Rik	UTSW	12	71,184,683 (GRCm39)	missense	probably benign
PIT1430001:2700049A03Rik	UTSW	12	71,207,160 (GRCm39)	missense	possibly damaging	0.71
PIT4519001:2700049A03Rik	UTSW	12	71,217,440 (GRCm39)	missense	probably benign	0.05
R0108:2700049A03Rik	UTSW	12	71,224,692 (GRCm39)	missense	probably benign	0.14
R0165:2700049A03Rik	UTSW	12	71,213,924 (GRCm39)	missense	possibly damaging	0.52
R0211:2700049A03Rik	UTSW	12	71,262,870 (GRCm39)	missense	possibly damaging	0.96
R0211:2700049A03Rik	UTSW	12	71,262,870 (GRCm39)	missense	possibly damaging	0.96
R0220:2700049A03Rik	UTSW	12	71,195,194 (GRCm39)	critical splice donor site	probably null
R0352:2700049A03Rik	UTSW	12	71,184,804 (GRCm39)	missense	possibly damaging	0.96
R0468:2700049A03Rik	UTSW	12	71,240,084 (GRCm39)	missense	possibly damaging	0.71
R0508:2700049A03Rik	UTSW	12	71,211,162 (GRCm39)	missense	probably damaging	0.98
R0673:2700049A03Rik	UTSW	12	71,224,642 (GRCm39)	missense	probably damaging	0.97
R0840:2700049A03Rik	UTSW	12	71,205,657 (GRCm39)	missense	probably benign	0.16
R0893:2700049A03Rik	UTSW	12	71,266,082 (GRCm39)	splice site	probably benign
R1244:2700049A03Rik	UTSW	12	71,262,918 (GRCm39)	missense	probably benign	0.25
R1432:2700049A03Rik	UTSW	12	71,217,361 (GRCm39)	splice site	probably null
R1599:2700049A03Rik	UTSW	12	71,197,033 (GRCm39)	missense	probably damaging	0.98
R1732:2700049A03Rik	UTSW	12	71,265,995 (GRCm39)	missense	probably benign	0.18
R1820:2700049A03Rik	UTSW	12	71,197,018 (GRCm39)	missense	possibly damaging	0.51
R1939:2700049A03Rik	UTSW	12	71,207,186 (GRCm39)	splice site	probably null
R1998:2700049A03Rik	UTSW	12	71,235,393 (GRCm39)	missense	possibly damaging	0.86
R2337:2700049A03Rik	UTSW	12	71,211,321 (GRCm39)	missense	possibly damaging	0.93
R2337:2700049A03Rik	UTSW	12	71,211,320 (GRCm39)	nonsense	probably null
R2340:2700049A03Rik	UTSW	12	71,211,321 (GRCm39)	missense	possibly damaging	0.93
R2340:2700049A03Rik	UTSW	12	71,211,320 (GRCm39)	nonsense	probably null
R2382:2700049A03Rik	UTSW	12	71,211,321 (GRCm39)	missense	possibly damaging	0.93
R2382:2700049A03Rik	UTSW	12	71,211,320 (GRCm39)	nonsense	probably null
R2384:2700049A03Rik	UTSW	12	71,211,321 (GRCm39)	missense	possibly damaging	0.93
R2384:2700049A03Rik	UTSW	12	71,211,320 (GRCm39)	nonsense	probably null
R2445:2700049A03Rik	UTSW	12	71,211,321 (GRCm39)	missense	possibly damaging	0.93
R2445:2700049A03Rik	UTSW	12	71,211,320 (GRCm39)	nonsense	probably null
R2449:2700049A03Rik	UTSW	12	71,211,321 (GRCm39)	missense	possibly damaging	0.93
R2449:2700049A03Rik	UTSW	12	71,211,320 (GRCm39)	nonsense	probably null
R2512:2700049A03Rik	UTSW	12	71,219,945 (GRCm39)	missense	possibly damaging	0.71
R2872:2700049A03Rik	UTSW	12	71,201,530 (GRCm39)	splice site	probably benign
R3236:2700049A03Rik	UTSW	12	71,211,321 (GRCm39)	missense	possibly damaging	0.93
R3236:2700049A03Rik	UTSW	12	71,211,320 (GRCm39)	nonsense	probably null
R3237:2700049A03Rik	UTSW	12	71,211,321 (GRCm39)	missense	possibly damaging	0.93
R3237:2700049A03Rik	UTSW	12	71,211,320 (GRCm39)	nonsense	probably null
R3734:2700049A03Rik	UTSW	12	71,211,321 (GRCm39)	missense	possibly damaging	0.93
R3734:2700049A03Rik	UTSW	12	71,211,320 (GRCm39)	nonsense	probably null
R3808:2700049A03Rik	UTSW	12	71,211,320 (GRCm39)	nonsense	probably null
R3808:2700049A03Rik	UTSW	12	71,211,321 (GRCm39)	missense	possibly damaging	0.93
R3809:2700049A03Rik	UTSW	12	71,211,320 (GRCm39)	nonsense	probably null
R3809:2700049A03Rik	UTSW	12	71,211,321 (GRCm39)	missense	possibly damaging	0.93
R3944:2700049A03Rik	UTSW	12	71,211,320 (GRCm39)	nonsense	probably null
R3944:2700049A03Rik	UTSW	12	71,211,321 (GRCm39)	missense	possibly damaging	0.93
R3959:2700049A03Rik	UTSW	12	71,211,320 (GRCm39)	nonsense	probably null
R3959:2700049A03Rik	UTSW	12	71,211,321 (GRCm39)	missense	possibly damaging	0.93
R3960:2700049A03Rik	UTSW	12	71,211,320 (GRCm39)	nonsense	probably null
R3960:2700049A03Rik	UTSW	12	71,211,321 (GRCm39)	missense	possibly damaging	0.93
R4593:2700049A03Rik	UTSW	12	71,211,320 (GRCm39)	nonsense	probably null
R4593:2700049A03Rik	UTSW	12	71,211,321 (GRCm39)	missense	possibly damaging	0.93
R4595:2700049A03Rik	UTSW	12	71,211,320 (GRCm39)	nonsense	probably null
R4595:2700049A03Rik	UTSW	12	71,211,321 (GRCm39)	missense	possibly damaging	0.93
R4596:2700049A03Rik	UTSW	12	71,211,320 (GRCm39)	nonsense	probably null
R4596:2700049A03Rik	UTSW	12	71,211,321 (GRCm39)	missense	possibly damaging	0.93
R4600:2700049A03Rik	UTSW	12	71,195,037 (GRCm39)	missense	possibly damaging	0.67
R4649:2700049A03Rik	UTSW	12	71,211,320 (GRCm39)	nonsense	probably null
R4649:2700049A03Rik	UTSW	12	71,211,321 (GRCm39)	missense	possibly damaging	0.93
R4651:2700049A03Rik	UTSW	12	71,211,321 (GRCm39)	missense	possibly damaging	0.93
R4651:2700049A03Rik	UTSW	12	71,211,320 (GRCm39)	nonsense	probably null
R4652:2700049A03Rik	UTSW	12	71,211,321 (GRCm39)	missense	possibly damaging	0.93
R4652:2700049A03Rik	UTSW	12	71,211,320 (GRCm39)	nonsense	probably null
R4714:2700049A03Rik	UTSW	12	71,211,321 (GRCm39)	missense	possibly damaging	0.93
R4714:2700049A03Rik	UTSW	12	71,211,320 (GRCm39)	nonsense	probably null
R4735:2700049A03Rik	UTSW	12	71,262,897 (GRCm39)	missense	possibly damaging	0.88
R4810:2700049A03Rik	UTSW	12	71,236,216 (GRCm39)	missense	possibly damaging	0.51
R4852:2700049A03Rik	UTSW	12	71,211,321 (GRCm39)	missense	possibly damaging	0.93
R4852:2700049A03Rik	UTSW	12	71,211,320 (GRCm39)	nonsense	probably null
R4854:2700049A03Rik	UTSW	12	71,211,321 (GRCm39)	missense	possibly damaging	0.93
R4854:2700049A03Rik	UTSW	12	71,211,320 (GRCm39)	nonsense	probably null
R4855:2700049A03Rik	UTSW	12	71,211,321 (GRCm39)	missense	possibly damaging	0.93
R4855:2700049A03Rik	UTSW	12	71,211,320 (GRCm39)	nonsense	probably null
R4884:2700049A03Rik	UTSW	12	71,211,320 (GRCm39)	nonsense	probably null
R4884:2700049A03Rik	UTSW	12	71,211,321 (GRCm39)	missense	possibly damaging	0.93
R4893:2700049A03Rik	UTSW	12	71,211,320 (GRCm39)	nonsense	probably null
R4893:2700049A03Rik	UTSW	12	71,211,321 (GRCm39)	missense	possibly damaging	0.93
R4905:2700049A03Rik	UTSW	12	71,211,320 (GRCm39)	nonsense	probably null
R4905:2700049A03Rik	UTSW	12	71,211,321 (GRCm39)	missense	possibly damaging	0.93
R4915:2700049A03Rik	UTSW	12	71,236,420 (GRCm39)	missense	possibly damaging	0.92
R4919:2700049A03Rik	UTSW	12	71,211,320 (GRCm39)	nonsense	probably null
R4919:2700049A03Rik	UTSW	12	71,211,321 (GRCm39)	missense	possibly damaging	0.93
R4959:2700049A03Rik	UTSW	12	71,211,320 (GRCm39)	nonsense	probably null
R4959:2700049A03Rik	UTSW	12	71,211,321 (GRCm39)	missense	possibly damaging	0.93
R4989:2700049A03Rik	UTSW	12	71,211,320 (GRCm39)	nonsense	probably null
R4989:2700049A03Rik	UTSW	12	71,211,321 (GRCm39)	missense	possibly damaging	0.93
R5011:2700049A03Rik	UTSW	12	71,211,320 (GRCm39)	nonsense	probably null
R5011:2700049A03Rik	UTSW	12	71,211,321 (GRCm39)	missense	possibly damaging	0.93
R5012:2700049A03Rik	UTSW	12	71,211,320 (GRCm39)	nonsense	probably null
R5012:2700049A03Rik	UTSW	12	71,211,321 (GRCm39)	missense	possibly damaging	0.93
R5118:2700049A03Rik	UTSW	12	71,211,320 (GRCm39)	nonsense	probably null
R5118:2700049A03Rik	UTSW	12	71,211,321 (GRCm39)	missense	possibly damaging	0.93
R5146:2700049A03Rik	UTSW	12	71,289,799 (GRCm39)	missense	possibly damaging	0.85
R5163:2700049A03Rik	UTSW	12	71,211,320 (GRCm39)	nonsense	probably null
R5163:2700049A03Rik	UTSW	12	71,211,321 (GRCm39)	missense	possibly damaging	0.93
R5188:2700049A03Rik	UTSW	12	71,211,320 (GRCm39)	nonsense	probably null
R5188:2700049A03Rik	UTSW	12	71,211,321 (GRCm39)	missense	possibly damaging	0.93
R5189:2700049A03Rik	UTSW	12	71,211,320 (GRCm39)	nonsense	probably null
R5189:2700049A03Rik	UTSW	12	71,211,321 (GRCm39)	missense	possibly damaging	0.93
R5189:2700049A03Rik	UTSW	12	71,240,123 (GRCm39)	missense	possibly damaging	0.93
R5190:2700049A03Rik	UTSW	12	71,211,320 (GRCm39)	nonsense	probably null
R5190:2700049A03Rik	UTSW	12	71,211,321 (GRCm39)	missense	possibly damaging	0.93
R5290:2700049A03Rik	UTSW	12	71,235,565 (GRCm39)	missense	probably benign	0.00
R5344:2700049A03Rik	UTSW	12	71,289,801 (GRCm39)	missense	probably benign
R5502:2700049A03Rik	UTSW	12	71,211,321 (GRCm39)	missense	possibly damaging	0.93
R5502:2700049A03Rik	UTSW	12	71,211,320 (GRCm39)	nonsense	probably null
R5503:2700049A03Rik	UTSW	12	71,211,321 (GRCm39)	missense	possibly damaging	0.93
R5503:2700049A03Rik	UTSW	12	71,211,320 (GRCm39)	nonsense	probably null
R5619:2700049A03Rik	UTSW	12	71,211,321 (GRCm39)	missense	possibly damaging	0.93
R5619:2700049A03Rik	UTSW	12	71,211,320 (GRCm39)	nonsense	probably null
R5667:2700049A03Rik	UTSW	12	71,211,321 (GRCm39)	missense	possibly damaging	0.93
R5667:2700049A03Rik	UTSW	12	71,211,320 (GRCm39)	nonsense	probably null
R5669:2700049A03Rik	UTSW	12	71,211,321 (GRCm39)	missense	possibly damaging	0.93
R5669:2700049A03Rik	UTSW	12	71,211,320 (GRCm39)	nonsense	probably null
R5671:2700049A03Rik	UTSW	12	71,211,320 (GRCm39)	nonsense	probably null
R5671:2700049A03Rik	UTSW	12	71,211,321 (GRCm39)	missense	possibly damaging	0.93
R5725:2700049A03Rik	UTSW	12	71,240,093 (GRCm39)	missense	probably benign	0.05
R5956:2700049A03Rik	UTSW	12	71,203,893 (GRCm39)	missense	possibly damaging	0.86
R6051:2700049A03Rik	UTSW	12	71,231,304 (GRCm39)	missense	possibly damaging	0.84
R6148:2700049A03Rik	UTSW	12	71,234,200 (GRCm39)	missense	possibly damaging	0.71
R6158:2700049A03Rik	UTSW	12	71,217,410 (GRCm39)	missense	possibly damaging	0.51
R6916:2700049A03Rik	UTSW	12	71,211,318 (GRCm39)	missense	possibly damaging	0.86
R7129:2700049A03Rik	UTSW	12	71,263,004 (GRCm39)	splice site	probably null
R7168:2700049A03Rik	UTSW	12	71,262,831 (GRCm39)	missense	probably damaging	0.98
R7193:2700049A03Rik	UTSW	12	71,265,963 (GRCm39)	critical splice acceptor site	probably null
R7359:2700049A03Rik	UTSW	12	71,236,348 (GRCm39)	missense	possibly damaging	0.51
R7488:2700049A03Rik	UTSW	12	71,197,179 (GRCm39)	missense	possibly damaging	0.67
R7755:2700049A03Rik	UTSW	12	71,236,187 (GRCm39)	missense	probably benign	0.02
R7757:2700049A03Rik	UTSW	12	71,236,187 (GRCm39)	missense	probably benign	0.02
R7922:2700049A03Rik	UTSW	12	71,211,180 (GRCm39)	missense	possibly damaging	0.83
R7966:2700049A03Rik	UTSW	12	71,219,903 (GRCm39)	missense	probably benign	0.00
R8082:2700049A03Rik	UTSW	12	71,188,895 (GRCm39)	critical splice donor site	probably null
R8311:2700049A03Rik	UTSW	12	71,184,815 (GRCm39)	unclassified	probably benign
R8408:2700049A03Rik	UTSW	12	71,236,356 (GRCm39)	missense	possibly damaging	0.71
R8852:2700049A03Rik	UTSW	12	71,231,197 (GRCm39)	missense	possibly damaging	0.93
R8860:2700049A03Rik	UTSW	12	71,231,197 (GRCm39)	missense	possibly damaging	0.93
R9039:2700049A03Rik	UTSW	12	71,213,849 (GRCm39)	missense	possibly damaging	0.51
R9281:2700049A03Rik	UTSW	12	71,205,687 (GRCm39)	missense	possibly damaging	0.51
R9308:2700049A03Rik	UTSW	12	71,231,233 (GRCm39)	missense	probably benign	0.23
R9385:2700049A03Rik	UTSW	12	71,207,966 (GRCm39)	missense	possibly damaging	0.52
R9412:2700049A03Rik	UTSW	12	71,235,457 (GRCm39)	missense	possibly damaging	0.71
R9643:2700049A03Rik	UTSW	12	71,211,189 (GRCm39)	missense	possibly damaging	0.92
R9676:2700049A03Rik	UTSW	12	71,207,905 (GRCm39)	missense	possibly damaging	0.86
R9776:2700049A03Rik	UTSW	12	71,235,448 (GRCm39)	missense	possibly damaging	0.71
R9789:2700049A03Rik	UTSW	12	71,231,357 (GRCm39)	missense	probably benign
Z1177:2700049A03Rik	UTSW	12	71,211,258 (GRCm39)	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- ACTGCACGTTGCTCATTCACTG -3'
(R):5'- CTGGCTCGATGTCACTGAATG -3'

Sequencing Primer
(F):5'- ACTGAGAAATCCTCGTGTGC -3'
(R):5'- GCTCGATGTCACTGAATGTTATC -3'

Posted On

2019-06-26