Incidental Mutation 'R7200:Tc2n'
ID560249
Institutional Source Beutler Lab
Gene Symbol Tc2n
Ensembl Gene ENSMUSG00000021187
Gene Nametandem C2 domains, nuclear
Synonyms4933406D09Rik, Tac2-N, Mtac2d1
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.074) question?
Stock #R7200 (G1)
Quality Score165.009
Status Not validated
Chromosome12
Chromosomal Location101645443-101718523 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to G at 101689055 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Leucine at position 214 (I214L)
Ref Sequence ENSEMBL: ENSMUSP00000125288 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000110047] [ENSMUST00000160715] [ENSMUST00000160830] [ENSMUST00000162735]
Predicted Effect probably damaging
Transcript: ENSMUST00000110047
AA Change: I214L

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000105674
Gene: ENSMUSG00000021187
AA Change: I214L

DomainStartEndE-ValueType
low complexity region 162 173 N/A INTRINSIC
low complexity region 190 210 N/A INTRINSIC
C2 238 339 5.56e0 SMART
C2 366 472 1.02e-3 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000160715
AA Change: I214L

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000125099
Gene: ENSMUSG00000021187
AA Change: I214L

DomainStartEndE-ValueType
low complexity region 162 173 N/A INTRINSIC
low complexity region 190 210 N/A INTRINSIC
Blast:C2 238 287 1e-24 BLAST
C2 302 408 1.02e-3 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000160830
AA Change: I214L

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000124287
Gene: ENSMUSG00000021187
AA Change: I214L

DomainStartEndE-ValueType
low complexity region 162 173 N/A INTRINSIC
low complexity region 190 210 N/A INTRINSIC
C2 238 339 5.56e0 SMART
C2 366 472 1.02e-3 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000162735
AA Change: I214L

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000125288
Gene: ENSMUSG00000021187
AA Change: I214L

DomainStartEndE-ValueType
low complexity region 162 173 N/A INTRINSIC
low complexity region 190 210 N/A INTRINSIC
C2 238 339 5.56e0 SMART
C2 366 472 1.02e-3 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.4%
  • 20x: 97.8%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 51 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700086D15Rik A G 11: 65,153,010 M75T unknown Het
2700049A03Rik T G 12: 71,140,906 N105K probably damaging Het
Acvr1c A T 2: 58,315,855 V31E probably damaging Het
Adra1d T A 2: 131,561,250 T307S probably benign Het
Akr1c14 T C 13: 4,081,051 Y248H probably benign Het
Ankub1 T C 3: 57,672,985 T84A probably benign Het
Asb3 C A 11: 30,998,348 S8* probably null Het
AU041133 G A 10: 82,151,101 G196D possibly damaging Het
B4galt7 T C 13: 55,608,342 C214R probably damaging Het
Chd3 A G 11: 69,364,095 S140P possibly damaging Het
Ciz1 T C 2: 32,364,287 L80P probably damaging Het
Col6a4 G A 9: 106,072,249 P729L possibly damaging Het
Cr2 A G 1: 195,163,249 C133R probably damaging Het
Dmgdh T C 13: 93,691,885 L178P probably damaging Het
Dock5 C A 14: 67,771,702 E1448* probably null Het
Elavl1 A G 8: 4,311,767 S2P probably benign Het
Flywch1 T C 17: 23,761,059 H247R possibly damaging Het
Gabpb1 A T 2: 126,639,302 I309N possibly damaging Het
Glrx3 T C 7: 137,464,436 F298L possibly damaging Het
Gm9573 TCCTGAGGCAGTGCTGGATACAGGGGTGGTTGGGGTGGGTGAAGAGCCTGAGGCAGTGCTGGAT TCCTGAGGCAGTGCTGGAT 17: 35,622,633 probably benign Het
Gpc6 G A 14: 117,964,856 V493I probably benign Het
H2-Bl A T 17: 36,081,046 I45N possibly damaging Het
Hadha C T 5: 30,145,317 E78K probably benign Het
Hjurp TCTGGGAGGGCTTGCTCCGGGGGCAGTGTGTCCTGTTCTTGTGCAGCCCCTGCT TCT 1: 88,266,278 probably benign Het
Ldlrad3 G T 2: 102,113,558 F56L probably damaging Het
Ldlrad3 A G 2: 102,113,560 F56L probably damaging Het
Mapk4 A T 18: 73,930,919 S411T possibly damaging Het
Mcm9 A G 10: 53,615,923 M382T Het
Olfr1457 T C 19: 13,095,232 T139A probably benign Het
Olfr720 A T 14: 14,175,477 C202S probably damaging Het
Pacs1 A C 19: 5,156,413 I248S possibly damaging Het
Pi16 C A 17: 29,319,234 P7Q possibly damaging Het
Plekhg1 T C 10: 3,956,810 S631P Het
Rars2 A T 4: 34,645,747 K221N probably benign Het
Retsat T C 6: 72,606,019 S388P possibly damaging Het
Rft1 G A 14: 30,682,857 probably null Het
Rgsl1 A G 1: 153,785,199 V345A probably benign Het
Rnf38 A T 4: 44,137,620 S320R probably benign Het
Sel1l3 T A 5: 53,144,109 Y722F probably benign Het
Slc13a4 T C 6: 35,287,350 E194G possibly damaging Het
Spata17 G A 1: 187,112,503 R300C probably benign Het
Tacc1 G A 8: 25,241,640 probably benign Het
Tet2 T C 3: 133,487,192 S494G probably benign Het
Tmco5b A T 2: 113,291,377 I179L probably damaging Het
Triobp AGGGACAATCCCAGGGCCTCCTCTCCCAACAGAACTACTCAGCGGGACAA AGGGACAA 15: 78,966,842 probably benign Het
Trpv1 A G 11: 73,239,586 T173A probably damaging Het
Vmn2r56 C T 7: 12,710,332 G458R probably damaging Het
Vmn2r81 T G 10: 79,270,736 probably null Het
Wfdc15b T A 2: 164,215,117 E80D probably benign Het
Wrn A T 8: 33,322,348 D423E probably benign Het
Zfp775 T A 6: 48,620,481 C430S possibly damaging Het
Other mutations in Tc2n
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01656:Tc2n APN 12 101649089 utr 3 prime probably benign
IGL02129:Tc2n APN 12 101689789 missense probably damaging 0.99
IGL02630:Tc2n APN 12 101693145 missense probably damaging 0.99
R0517:Tc2n UTSW 12 101649195 missense probably damaging 0.98
R0980:Tc2n UTSW 12 101678576 nonsense probably null
R1676:Tc2n UTSW 12 101688992 missense probably damaging 1.00
R2187:Tc2n UTSW 12 101706544 missense probably damaging 1.00
R3771:Tc2n UTSW 12 101694574 missense possibly damaging 0.68
R4082:Tc2n UTSW 12 101651155 missense possibly damaging 0.85
R4180:Tc2n UTSW 12 101665695 missense probably damaging 1.00
R4707:Tc2n UTSW 12 101694573 missense probably benign 0.16
R4793:Tc2n UTSW 12 101651117 missense possibly damaging 0.86
R4917:Tc2n UTSW 12 101665695 missense probably damaging 1.00
R5214:Tc2n UTSW 12 101693202 nonsense probably null
R5870:Tc2n UTSW 12 101652852 missense probably damaging 1.00
R6034:Tc2n UTSW 12 101651201 splice site probably null
R6034:Tc2n UTSW 12 101651201 splice site probably null
R6128:Tc2n UTSW 12 101709489 start codon destroyed probably null 0.99
R7469:Tc2n UTSW 12 101665675 missense probably damaging 1.00
R7471:Tc2n UTSW 12 101706457 missense probably damaging 0.99
R7730:Tc2n UTSW 12 101651147 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- AAGCCACACTAGATACTTGTAGG -3'
(R):5'- TATTTCTAGGACTTCACAAAACCCC -3'

Sequencing Primer
(F):5'- TTTACCTGCAAAACTGTGA -3'
(R):5'- AGTTCAAGGCCAGCTTGATC -3'
Posted On2019-06-26