Incidental Mutation 'R7200:Gpc6'
ID560256
Institutional Source Beutler Lab
Gene Symbol Gpc6
Ensembl Gene ENSMUSG00000058571
Gene Nameglypican 6
Synonyms6720429C22Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.181) question?
Stock #R7200 (G1)
Quality Score225.009
Status Not validated
Chromosome14
Chromosomal Location116925315-117976544 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 117964856 bp
ZygosityHeterozygous
Amino Acid Change Valine to Isoleucine at position 493 (V493I)
Ref Sequence ENSEMBL: ENSMUSP00000120362 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000078849] [ENSMUST00000088483] [ENSMUST00000125435]
Predicted Effect possibly damaging
Transcript: ENSMUST00000078849
AA Change: V483I

PolyPhen 2 Score 0.580 (Sensitivity: 0.88; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000077893
Gene: ENSMUSG00000058571
AA Change: V483I

DomainStartEndE-ValueType
Pfam:Glypican 7 554 9.3e-247 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000088483
AA Change: V483I

PolyPhen 2 Score 0.580 (Sensitivity: 0.88; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000085835
Gene: ENSMUSG00000058571
AA Change: V483I

DomainStartEndE-ValueType
Pfam:Glypican 7 554 9.3e-247 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000125435
AA Change: V493I

PolyPhen 2 Score 0.077 (Sensitivity: 0.93; Specificity: 0.85)
SMART Domains Protein: ENSMUSP00000120362
Gene: ENSMUSG00000058571
AA Change: V493I

DomainStartEndE-ValueType
Pfam:Glypican 15 564 7.2e-248 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.4%
  • 20x: 97.8%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The glypicans comprise a family of glycosylphosphatidylinositol-anchored heparan sulfate proteoglycans, and they have been implicated in the control of cell growth and cell division. The glypican encoded by this gene is a putative cell surface coreceptor for growth factors, extracellular matrix proteins, proteases and anti-proteases. Mutations in this gene are associated with omodysplasia 1. [provided by RefSeq, Nov 2016]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit neonatal lethality, decreased fetal weight, short long bones, small skull, small snout, cleft palate and decreased chondrocyte proliferation. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 51 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700086D15Rik A G 11: 65,153,010 M75T unknown Het
2700049A03Rik T G 12: 71,140,906 N105K probably damaging Het
Acvr1c A T 2: 58,315,855 V31E probably damaging Het
Adra1d T A 2: 131,561,250 T307S probably benign Het
Akr1c14 T C 13: 4,081,051 Y248H probably benign Het
Ankub1 T C 3: 57,672,985 T84A probably benign Het
Asb3 C A 11: 30,998,348 S8* probably null Het
AU041133 G A 10: 82,151,101 G196D possibly damaging Het
B4galt7 T C 13: 55,608,342 C214R probably damaging Het
Chd3 A G 11: 69,364,095 S140P possibly damaging Het
Ciz1 T C 2: 32,364,287 L80P probably damaging Het
Col6a4 G A 9: 106,072,249 P729L possibly damaging Het
Cr2 A G 1: 195,163,249 C133R probably damaging Het
Dmgdh T C 13: 93,691,885 L178P probably damaging Het
Dock5 C A 14: 67,771,702 E1448* probably null Het
Elavl1 A G 8: 4,311,767 S2P probably benign Het
Flywch1 T C 17: 23,761,059 H247R possibly damaging Het
Gabpb1 A T 2: 126,639,302 I309N possibly damaging Het
Glrx3 T C 7: 137,464,436 F298L possibly damaging Het
Gm9573 TCCTGAGGCAGTGCTGGATACAGGGGTGGTTGGGGTGGGTGAAGAGCCTGAGGCAGTGCTGGAT TCCTGAGGCAGTGCTGGAT 17: 35,622,633 probably benign Het
H2-Bl A T 17: 36,081,046 I45N possibly damaging Het
Hadha C T 5: 30,145,317 E78K probably benign Het
Hjurp TCTGGGAGGGCTTGCTCCGGGGGCAGTGTGTCCTGTTCTTGTGCAGCCCCTGCT TCT 1: 88,266,278 probably benign Het
Ldlrad3 G T 2: 102,113,558 F56L probably damaging Het
Ldlrad3 A G 2: 102,113,560 F56L probably damaging Het
Mapk4 A T 18: 73,930,919 S411T possibly damaging Het
Mcm9 A G 10: 53,615,923 M382T Het
Olfr1457 T C 19: 13,095,232 T139A probably benign Het
Olfr720 A T 14: 14,175,477 C202S probably damaging Het
Pacs1 A C 19: 5,156,413 I248S possibly damaging Het
Pi16 C A 17: 29,319,234 P7Q possibly damaging Het
Plekhg1 T C 10: 3,956,810 S631P Het
Rars2 A T 4: 34,645,747 K221N probably benign Het
Retsat T C 6: 72,606,019 S388P possibly damaging Het
Rft1 G A 14: 30,682,857 probably null Het
Rgsl1 A G 1: 153,785,199 V345A probably benign Het
Rnf38 A T 4: 44,137,620 S320R probably benign Het
Sel1l3 T A 5: 53,144,109 Y722F probably benign Het
Slc13a4 T C 6: 35,287,350 E194G possibly damaging Het
Spata17 G A 1: 187,112,503 R300C probably benign Het
Tacc1 G A 8: 25,241,640 probably benign Het
Tc2n T G 12: 101,689,055 I214L probably damaging Het
Tet2 T C 3: 133,487,192 S494G probably benign Het
Tmco5b A T 2: 113,291,377 I179L probably damaging Het
Triobp AGGGACAATCCCAGGGCCTCCTCTCCCAACAGAACTACTCAGCGGGACAA AGGGACAA 15: 78,966,842 probably benign Het
Trpv1 A G 11: 73,239,586 T173A probably damaging Het
Vmn2r56 C T 7: 12,710,332 G458R probably damaging Het
Vmn2r81 T G 10: 79,270,736 probably null Het
Wfdc15b T A 2: 164,215,117 E80D probably benign Het
Wrn A T 8: 33,322,348 D423E probably benign Het
Zfp775 T A 6: 48,620,481 C430S possibly damaging Het
Other mutations in Gpc6
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00597:Gpc6 APN 14 117951234 missense probably benign 0.01
IGL00671:Gpc6 APN 14 117186787 missense probably benign 0.01
IGL00928:Gpc6 APN 14 116925958 missense possibly damaging 0.86
IGL01343:Gpc6 APN 14 117186812 missense possibly damaging 0.54
IGL01545:Gpc6 APN 14 117964830 missense probably damaging 1.00
IGL02797:Gpc6 APN 14 116925982 missense probably damaging 0.98
PIT1430001:Gpc6 UTSW 14 117951182 nonsense probably null
R0577:Gpc6 UTSW 14 117436008 missense probably benign 0.03
R0611:Gpc6 UTSW 14 117975018 missense probably null
R0636:Gpc6 UTSW 14 117624493 missense probably benign 0.37
R2152:Gpc6 UTSW 14 116926092 missense probably benign 0.00
R2242:Gpc6 UTSW 14 117186787 missense probably benign 0.01
R2266:Gpc6 UTSW 14 117888520 critical splice acceptor site probably null
R2267:Gpc6 UTSW 14 117888520 critical splice acceptor site probably null
R2269:Gpc6 UTSW 14 117888520 critical splice acceptor site probably null
R3788:Gpc6 UTSW 14 117624466 missense probably damaging 0.98
R4255:Gpc6 UTSW 14 117951141 missense probably benign 0.15
R4276:Gpc6 UTSW 14 117435916 missense probably damaging 0.99
R4411:Gpc6 UTSW 14 117951178 missense probably benign 0.45
R4626:Gpc6 UTSW 14 117964843 nonsense probably null
R4993:Gpc6 UTSW 14 117624539 missense possibly damaging 0.93
R5070:Gpc6 UTSW 14 117186769 missense probably benign 0.01
R6007:Gpc6 UTSW 14 117951261 missense probably damaging 1.00
R6058:Gpc6 UTSW 14 117964770 missense probably damaging 1.00
R6488:Gpc6 UTSW 14 117964713 missense possibly damaging 0.73
R6901:Gpc6 UTSW 14 117951217 missense possibly damaging 0.87
R6981:Gpc6 UTSW 14 117624548 missense probably damaging 0.98
Predicted Primers PCR Primer
(F):5'- TCCCATCTGAGATAGCAGGG -3'
(R):5'- GTACATTGTGCCTCAGACCG -3'

Sequencing Primer
(F):5'- TGGTTCTGAGGTCACCACAAC -3'
(R):5'- GTGCCTCAGACCGGAAAAACTTTG -3'
Posted On2019-06-26