Incidental Mutation 'R7200:H2-Bl'
ID560261
Institutional Source Beutler Lab
Gene Symbol H2-Bl
Ensembl Gene ENSMUSG00000073406
Gene Namehistocompatibility 2, blastocyst
Synonymsblastocyst MHC
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.081) question?
Stock #R7200 (G1)
Quality Score225.009
Status Not validated
Chromosome17
Chromosomal Location36080115-36084223 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 36081046 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Asparagine at position 45 (I45N)
Ref Sequence ENSEMBL: ENSMUSP00000138812 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000173080] [ENSMUST00000183560] [ENSMUST00000183999] [ENSMUST00000184502] [ENSMUST00000185087] [ENSMUST00000185167] [ENSMUST00000192532] [ENSMUST00000194244] [ENSMUST00000195833] [ENSMUST00000195838]
Predicted Effect probably benign
Transcript: ENSMUST00000173080
AA Change: I319N

PolyPhen 2 Score 0.006 (Sensitivity: 0.97; Specificity: 0.75)
SMART Domains Protein: ENSMUSP00000134155
Gene: ENSMUSG00000073406
AA Change: I319N

DomainStartEndE-ValueType
signal peptide 1 21 N/A INTRINSIC
Pfam:MHC_I 22 200 1.6e-88 PFAM
IGc1 219 289 6.29e-19 SMART
transmembrane domain 305 327 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000183560
AA Change: I45N

PolyPhen 2 Score 0.827 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000138812
Gene: ENSMUSG00000073406
AA Change: I45N

DomainStartEndE-ValueType
signal peptide 1 21 N/A INTRINSIC
transmembrane domain 32 54 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000183999
AA Change: I59N

PolyPhen 2 Score 0.827 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000139165
Gene: ENSMUSG00000073406
AA Change: I59N

DomainStartEndE-ValueType
low complexity region 6 14 N/A INTRINSIC
SCOP:d1dr9a2 21 36 4e-5 SMART
transmembrane domain 46 68 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000184502
AA Change: I227N

PolyPhen 2 Score 0.876 (Sensitivity: 0.83; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000139275
Gene: ENSMUSG00000073406
AA Change: I227N

DomainStartEndE-ValueType
signal peptide 1 21 N/A INTRINSIC
Pfam:MHC_I 22 200 6.8e-89 PFAM
transmembrane domain 214 236 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000185087
SMART Domains Protein: ENSMUSP00000139166
Gene: ENSMUSG00000073406

DomainStartEndE-ValueType
signal peptide 1 21 N/A INTRINSIC
Pfam:MHC_I 22 113 5.2e-44 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000185167
SMART Domains Protein: ENSMUSP00000139373
Gene: ENSMUSG00000073406

DomainStartEndE-ValueType
signal peptide 1 21 N/A INTRINSIC
Predicted Effect
SMART Domains Protein: ENSMUSP00000142113
Gene: ENSMUSG00000073406
AA Change: I309N

DomainStartEndE-ValueType
Pfam:MHC_I 12 190 1.4e-88 PFAM
IGc1 209 279 6.29e-19 SMART
transmembrane domain 295 317 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000194244
AA Change: I227N

PolyPhen 2 Score 0.816 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000141809
Gene: ENSMUSG00000073406
AA Change: I227N

DomainStartEndE-ValueType
signal peptide 1 21 N/A INTRINSIC
Pfam:MHC_I 22 118 2.9e-43 PFAM
IGc1 127 197 6.29e-19 SMART
transmembrane domain 213 235 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000195833
AA Change: I216N

PolyPhen 2 Score 0.550 (Sensitivity: 0.88; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000141271
Gene: ENSMUSG00000073406
AA Change: I216N

DomainStartEndE-ValueType
Pfam:MHC_I 12 107 1.8e-37 PFAM
IGc1 116 186 6.29e-19 SMART
transmembrane domain 202 224 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000195838
AA Change: I308N

PolyPhen 2 Score 0.014 (Sensitivity: 0.96; Specificity: 0.79)
SMART Domains Protein: ENSMUSP00000141253
Gene: ENSMUSG00000073406
AA Change: I308N

DomainStartEndE-ValueType
Pfam:MHC_I 12 189 1e-82 PFAM
IGc1 208 278 6.29e-19 SMART
transmembrane domain 294 316 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.4%
  • 20x: 97.8%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 51 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700086D15Rik A G 11: 65,153,010 M75T unknown Het
2700049A03Rik T G 12: 71,140,906 N105K probably damaging Het
Acvr1c A T 2: 58,315,855 V31E probably damaging Het
Adra1d T A 2: 131,561,250 T307S probably benign Het
Akr1c14 T C 13: 4,081,051 Y248H probably benign Het
Ankub1 T C 3: 57,672,985 T84A probably benign Het
Asb3 C A 11: 30,998,348 S8* probably null Het
AU041133 G A 10: 82,151,101 G196D possibly damaging Het
B4galt7 T C 13: 55,608,342 C214R probably damaging Het
Chd3 A G 11: 69,364,095 S140P possibly damaging Het
Ciz1 T C 2: 32,364,287 L80P probably damaging Het
Col6a4 G A 9: 106,072,249 P729L possibly damaging Het
Cr2 A G 1: 195,163,249 C133R probably damaging Het
Dmgdh T C 13: 93,691,885 L178P probably damaging Het
Dock5 C A 14: 67,771,702 E1448* probably null Het
Elavl1 A G 8: 4,311,767 S2P probably benign Het
Flywch1 T C 17: 23,761,059 H247R possibly damaging Het
Gabpb1 A T 2: 126,639,302 I309N possibly damaging Het
Glrx3 T C 7: 137,464,436 F298L possibly damaging Het
Gm9573 TCCTGAGGCAGTGCTGGATACAGGGGTGGTTGGGGTGGGTGAAGAGCCTGAGGCAGTGCTGGAT TCCTGAGGCAGTGCTGGAT 17: 35,622,633 probably benign Het
Gpc6 G A 14: 117,964,856 V493I probably benign Het
Hadha C T 5: 30,145,317 E78K probably benign Het
Hjurp TCTGGGAGGGCTTGCTCCGGGGGCAGTGTGTCCTGTTCTTGTGCAGCCCCTGCT TCT 1: 88,266,278 probably benign Het
Ldlrad3 G T 2: 102,113,558 F56L probably damaging Het
Ldlrad3 A G 2: 102,113,560 F56L probably damaging Het
Mapk4 A T 18: 73,930,919 S411T possibly damaging Het
Mcm9 A G 10: 53,615,923 M382T Het
Olfr1457 T C 19: 13,095,232 T139A probably benign Het
Olfr720 A T 14: 14,175,477 C202S probably damaging Het
Pacs1 A C 19: 5,156,413 I248S possibly damaging Het
Pi16 C A 17: 29,319,234 P7Q possibly damaging Het
Plekhg1 T C 10: 3,956,810 S631P Het
Rars2 A T 4: 34,645,747 K221N probably benign Het
Retsat T C 6: 72,606,019 S388P possibly damaging Het
Rft1 G A 14: 30,682,857 probably null Het
Rgsl1 A G 1: 153,785,199 V345A probably benign Het
Rnf38 A T 4: 44,137,620 S320R probably benign Het
Sel1l3 T A 5: 53,144,109 Y722F probably benign Het
Slc13a4 T C 6: 35,287,350 E194G possibly damaging Het
Spata17 G A 1: 187,112,503 R300C probably benign Het
Tacc1 G A 8: 25,241,640 probably benign Het
Tc2n T G 12: 101,689,055 I214L probably damaging Het
Tet2 T C 3: 133,487,192 S494G probably benign Het
Tmco5b A T 2: 113,291,377 I179L probably damaging Het
Triobp AGGGACAATCCCAGGGCCTCCTCTCCCAACAGAACTACTCAGCGGGACAA AGGGACAA 15: 78,966,842 probably benign Het
Trpv1 A G 11: 73,239,586 T173A probably damaging Het
Vmn2r56 C T 7: 12,710,332 G458R probably damaging Het
Vmn2r81 T G 10: 79,270,736 probably null Het
Wfdc15b T A 2: 164,215,117 E80D probably benign Het
Wrn A T 8: 33,322,348 D423E probably benign Het
Zfp775 T A 6: 48,620,481 C430S possibly damaging Het
Other mutations in H2-Bl
AlleleSourceChrCoordTypePredicted EffectPPH Score
R0396:H2-Bl UTSW 17 36083722 missense possibly damaging 0.47
R0412:H2-Bl UTSW 17 36081521 splice site probably benign
R0924:H2-Bl UTSW 17 36083932 missense probably damaging 1.00
R1170:H2-Bl UTSW 17 36081091 missense possibly damaging 0.66
R1211:H2-Bl UTSW 17 36081073 missense probably damaging 1.00
R1902:H2-Bl UTSW 17 36083953 missense probably damaging 1.00
R1913:H2-Bl UTSW 17 36081016 missense probably damaging 0.99
R1992:H2-Bl UTSW 17 36081046 missense probably damaging 0.98
R5538:H2-Bl UTSW 17 36081286 missense probably benign 0.35
R6021:H2-Bl UTSW 17 36081274 missense probably damaging 1.00
R7091:H2-Bl UTSW 17 36083941 missense possibly damaging 0.94
R7711:H2-Bl UTSW 17 36083878 missense probably damaging 0.98
Predicted Primers PCR Primer
(F):5'- TCCCAGAACTGACAGAGGAC -3'
(R):5'- ATGTGTACCATGAGGGGCTG -3'

Sequencing Primer
(F):5'- CCCAGGTGGAGACAGTAGC -3'
(R):5'- AGTGCAGAGCTGGGGTC -3'
Posted On2019-06-26