Incidental Mutation 'R7200:Olfr1457'
ID560264
Institutional Source Beutler Lab
Gene Symbol Olfr1457
Ensembl Gene ENSMUSG00000061637
Gene Nameolfactory receptor 1457
SynonymsGA_x6K02T2RE5P-3423041-3422097, MOR202-20
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.070) question?
Stock #R7200 (G1)
Quality Score225.009
Status Not validated
Chromosome19
Chromosomal Location13093379-13097891 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 13095232 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Alanine at position 139 (T139A)
Ref Sequence ENSEMBL: ENSMUSP00000150957 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000075170] [ENSMUST00000208913] [ENSMUST00000214561] [ENSMUST00000215229]
Predicted Effect probably benign
Transcript: ENSMUST00000075170
AA Change: T139A

PolyPhen 2 Score 0.038 (Sensitivity: 0.94; Specificity: 0.82)
SMART Domains Protein: ENSMUSP00000074665
Gene: ENSMUSG00000061637
AA Change: T139A

DomainStartEndE-ValueType
Pfam:7tm_4 32 309 3.6e-45 PFAM
Pfam:7tm_1 42 291 9.6e-21 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000208913
Predicted Effect probably benign
Transcript: ENSMUST00000214561
Predicted Effect probably benign
Transcript: ENSMUST00000215229
AA Change: T139A

PolyPhen 2 Score 0.038 (Sensitivity: 0.94; Specificity: 0.82)
Meta Mutation Damage Score 0.0722 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.4%
  • 20x: 97.8%
Validation Efficiency
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 51 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700086D15Rik A G 11: 65,153,010 M75T unknown Het
2700049A03Rik T G 12: 71,140,906 N105K probably damaging Het
Acvr1c A T 2: 58,315,855 V31E probably damaging Het
Adra1d T A 2: 131,561,250 T307S probably benign Het
Akr1c14 T C 13: 4,081,051 Y248H probably benign Het
Ankub1 T C 3: 57,672,985 T84A probably benign Het
Asb3 C A 11: 30,998,348 S8* probably null Het
AU041133 G A 10: 82,151,101 G196D possibly damaging Het
B4galt7 T C 13: 55,608,342 C214R probably damaging Het
Chd3 A G 11: 69,364,095 S140P possibly damaging Het
Ciz1 T C 2: 32,364,287 L80P probably damaging Het
Col6a4 G A 9: 106,072,249 P729L possibly damaging Het
Cr2 A G 1: 195,163,249 C133R probably damaging Het
Dmgdh T C 13: 93,691,885 L178P probably damaging Het
Dock5 C A 14: 67,771,702 E1448* probably null Het
Elavl1 A G 8: 4,311,767 S2P probably benign Het
Flywch1 T C 17: 23,761,059 H247R possibly damaging Het
Gabpb1 A T 2: 126,639,302 I309N possibly damaging Het
Glrx3 T C 7: 137,464,436 F298L possibly damaging Het
Gm9573 TCCTGAGGCAGTGCTGGATACAGGGGTGGTTGGGGTGGGTGAAGAGCCTGAGGCAGTGCTGGAT TCCTGAGGCAGTGCTGGAT 17: 35,622,633 probably benign Het
Gpc6 G A 14: 117,964,856 V493I probably benign Het
H2-Bl A T 17: 36,081,046 I45N possibly damaging Het
Hadha C T 5: 30,145,317 E78K probably benign Het
Hjurp TCTGGGAGGGCTTGCTCCGGGGGCAGTGTGTCCTGTTCTTGTGCAGCCCCTGCT TCT 1: 88,266,278 probably benign Het
Ldlrad3 G T 2: 102,113,558 F56L probably damaging Het
Ldlrad3 A G 2: 102,113,560 F56L probably damaging Het
Mapk4 A T 18: 73,930,919 S411T possibly damaging Het
Mcm9 A G 10: 53,615,923 M382T Het
Olfr720 A T 14: 14,175,477 C202S probably damaging Het
Pacs1 A C 19: 5,156,413 I248S possibly damaging Het
Pi16 C A 17: 29,319,234 P7Q possibly damaging Het
Plekhg1 T C 10: 3,956,810 S631P Het
Rars2 A T 4: 34,645,747 K221N probably benign Het
Retsat T C 6: 72,606,019 S388P possibly damaging Het
Rft1 G A 14: 30,682,857 probably null Het
Rgsl1 A G 1: 153,785,199 V345A probably benign Het
Rnf38 A T 4: 44,137,620 S320R probably benign Het
Sel1l3 T A 5: 53,144,109 Y722F probably benign Het
Slc13a4 T C 6: 35,287,350 E194G possibly damaging Het
Spata17 G A 1: 187,112,503 R300C probably benign Het
Tacc1 G A 8: 25,241,640 probably benign Het
Tc2n T G 12: 101,689,055 I214L probably damaging Het
Tet2 T C 3: 133,487,192 S494G probably benign Het
Tmco5b A T 2: 113,291,377 I179L probably damaging Het
Triobp AGGGACAATCCCAGGGCCTCCTCTCCCAACAGAACTACTCAGCGGGACAA AGGGACAA 15: 78,966,842 probably benign Het
Trpv1 A G 11: 73,239,586 T173A probably damaging Het
Vmn2r56 C T 7: 12,710,332 G458R probably damaging Het
Vmn2r81 T G 10: 79,270,736 probably null Het
Wfdc15b T A 2: 164,215,117 E80D probably benign Het
Wrn A T 8: 33,322,348 D423E probably benign Het
Zfp775 T A 6: 48,620,481 C430S possibly damaging Het
Other mutations in Olfr1457
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01143:Olfr1457 APN 19 13095112 missense probably damaging 1.00
IGL01815:Olfr1457 APN 19 13095656 splice site probably null
IGL02033:Olfr1457 APN 19 13094857 missense possibly damaging 0.54
R0490:Olfr1457 UTSW 19 13094812 missense probably damaging 1.00
R1205:Olfr1457 UTSW 19 13095535 missense probably benign 0.01
R1299:Olfr1457 UTSW 19 13095130 missense possibly damaging 0.78
R1782:Olfr1457 UTSW 19 13094803 missense probably damaging 0.99
R1983:Olfr1457 UTSW 19 13095384 missense probably benign 0.01
R2364:Olfr1457 UTSW 19 13094754 missense probably damaging 1.00
R3815:Olfr1457 UTSW 19 13094913 missense probably damaging 0.98
R4092:Olfr1457 UTSW 19 13095426 missense probably damaging 0.97
R4430:Olfr1457 UTSW 19 13095088 missense probably benign 0.03
R8079:Olfr1457 UTSW 19 13095284 nonsense probably null
Predicted Primers PCR Primer
(F):5'- TGAAGTATCTGTCTGAGCAAGAG -3'
(R):5'- ATCCTGCTGATTGTCCTGGAC -3'

Sequencing Primer
(F):5'- GAGAACCATGACTGCTGGAATGTC -3'
(R):5'- GTCACACCTAGTGTCATGACTGAG -3'
Posted On2019-06-26