Incidental Mutation 'R0592:Elmod1'
ID56027
Institutional Source Beutler Lab
Gene Symbol Elmod1
Ensembl Gene ENSMUSG00000041986
Gene NameELMO/CED-12 domain containing 1
Synonyms
MMRRC Submission 038782-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R0592 (G1)
Quality Score225
Status Validated
Chromosome9
Chromosomal Location53911457-53975301 bp(-) (GRCm38)
Type of Mutationsplice site
DNA Base Change (assembly) A to G at 53926106 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000129082 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000048409] [ENSMUST00000166580]
Predicted Effect probably benign
Transcript: ENSMUST00000048409
SMART Domains Protein: ENSMUSP00000046191
Gene: ENSMUSG00000041986

DomainStartEndE-ValueType
Pfam:ELMO_CED12 117 295 3.8e-49 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000166580
SMART Domains Protein: ENSMUSP00000129082
Gene: ENSMUSG00000041986

DomainStartEndE-ValueType
Pfam:ELMO_CED12 114 296 9.6e-53 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000215313
Predicted Effect noncoding transcript
Transcript: ENSMUST00000216880
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.9%
  • 10x: 97.5%
  • 20x: 95.0%
Validation Efficiency 100% (35/35)
MGI Phenotype PHENOTYPE: Mice homozygous for a spontaneous allele exhibit circling, absent startle reflex, deafness, organ of Corti degeneration and abnormal cochlear hair stereociliary bundle. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 35 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Atg2a GCCTTCCTTCCTTCCTTCCTTCCTTCCTTCCTTCC GCCTTCCTTCCTTCCTTCCTTCCTTCCTTCCTTCCTTCC 19: 6,245,007 probably benign Het
Bbs7 A T 3: 36,610,297 V53D probably benign Het
Bglap T A 3: 88,383,655 I90F probably benign Het
C2cd4b G A 9: 67,760,691 R323H probably damaging Het
Cdh5 T A 8: 104,130,902 probably null Het
Cdh8 T A 8: 99,279,478 D159V probably damaging Het
Dnah7a A G 1: 53,456,612 Y3229H possibly damaging Het
Dzip1 T C 14: 118,902,139 E381G probably damaging Het
Exosc10 T C 4: 148,581,113 S811P probably benign Het
Fhl3 A G 4: 124,705,677 Y15C probably benign Het
Gstz1 G A 12: 87,163,721 S126N probably benign Het
Hey2 C A 10: 30,833,957 A267S probably benign Het
Iqce A T 5: 140,686,107 probably null Het
Katnal2 A T 18: 77,002,560 probably null Het
Kdm2b G A 5: 122,961,134 probably benign Het
Mov10l1 A G 15: 88,998,766 probably null Het
Numa1 A G 7: 102,013,897 T724A probably benign Het
Oas3 A G 5: 120,771,149 F244S probably damaging Het
Olfr1472 T C 19: 13,453,705 I271V probably benign Het
Olfr715 G A 7: 107,129,343 L17F probably benign Het
Ppil2 A G 16: 17,107,219 S30P probably benign Het
Rab37 T G 11: 115,160,523 probably benign Het
Riox2 T C 16: 59,489,579 probably benign Het
Ryr3 A G 2: 112,678,481 S3358P probably damaging Het
Sash1 T A 10: 8,729,782 H948L probably benign Het
Serpinb6e T A 13: 33,841,074 N78I probably damaging Het
Slc25a47 G A 12: 108,854,258 V63M probably damaging Het
Slc9b1 A T 3: 135,394,074 probably benign Het
Strip2 T A 6: 29,931,210 S387T probably benign Het
Tcaf3 T C 6: 42,596,843 N145S probably benign Het
Tex10 C T 4: 48,456,800 R637Q probably benign Het
Trmu T C 15: 85,896,826 probably benign Het
Vezf1 A T 11: 88,068,435 probably benign Het
Vmn2r116 C T 17: 23,386,915 T267I probably damaging Het
Whrn C A 4: 63,415,567 A450S probably damaging Het
Other mutations in Elmod1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00391:Elmod1 APN 9 53924398 critical splice donor site probably null
IGL01803:Elmod1 APN 9 53931480 missense probably benign 0.01
IGL01966:Elmod1 APN 9 53921327 missense probably benign 0.00
IGL02354:Elmod1 APN 9 53931558 missense probably damaging 1.00
IGL02361:Elmod1 APN 9 53931558 missense probably damaging 1.00
IGL03107:Elmod1 APN 9 53934223 splice site probably benign
IGL03277:Elmod1 APN 9 53925988 missense probably damaging 1.00
R0013:Elmod1 UTSW 9 53912901 splice site probably benign
R0013:Elmod1 UTSW 9 53912901 splice site probably benign
R0243:Elmod1 UTSW 9 53935547 splice site probably benign
R0530:Elmod1 UTSW 9 53925976 missense probably damaging 0.96
R0555:Elmod1 UTSW 9 53931592 splice site probably benign
R0670:Elmod1 UTSW 9 53912822 missense probably damaging 0.96
R1054:Elmod1 UTSW 9 53912774 missense probably benign 0.02
R1195:Elmod1 UTSW 9 53935768 missense probably damaging 1.00
R1195:Elmod1 UTSW 9 53935768 missense probably damaging 1.00
R1195:Elmod1 UTSW 9 53935768 missense probably damaging 1.00
R1875:Elmod1 UTSW 9 53935867 missense probably benign 0.00
R4445:Elmod1 UTSW 9 53934129 missense probably damaging 1.00
R4573:Elmod1 UTSW 9 53925972 missense probably damaging 1.00
R5895:Elmod1 UTSW 9 53935807 missense probably damaging 0.99
R6826:Elmod1 UTSW 9 53919599 missense probably benign 0.02
R7181:Elmod1 UTSW 9 53934098 intron probably null
R7334:Elmod1 UTSW 9 53934224 splice site probably null
R7422:Elmod1 UTSW 9 53912843 missense probably damaging 0.99
Z1088:Elmod1 UTSW 9 53919614 missense probably benign 0.00
Z1176:Elmod1 UTSW 9 53946860
Predicted Primers PCR Primer
(F):5'- ACAGACTAGCACATTGCCCTAATGC -3'
(R):5'- ACACCAGGTGACCTCAACATTTTCC -3'

Sequencing Primer
(F):5'- ATTGCCCTAATGCTCAACCATC -3'
(R):5'- TTGTCTTCAAAGCAACAGCTC -3'
Posted On2013-07-11