Incidental Mutation 'R7201:Ush2a'
ID 560272
Institutional Source Beutler Lab
Gene Symbol Ush2a
Ensembl Gene ENSMUSG00000026609
Gene Name usherin
Synonyms MUSH2A, LOC269160, LOC381317, Ushrn, Ush2a, A930037M10Rik, A930011D15Rik
MMRRC Submission 045279-MU
Accession Numbers
Essential gene? Possibly essential (E-score: 0.501) question?
Stock # R7201 (G1)
Quality Score 225.009
Status Validated
Chromosome 1
Chromosomal Location 187995035-188697694 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to G at 188606951 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Threonine to Alanine at position 3949 (T3949A)
Ref Sequence ENSEMBL: ENSMUSP00000050454 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000060479]
AlphaFold no structure available at present
Predicted Effect probably benign
Transcript: ENSMUST00000060479
AA Change: T3949A

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000050454
Gene: ENSMUSG00000026609
AA Change: T3949A

DomainStartEndE-ValueType
transmembrane domain 9 31 N/A INTRINSIC
Pfam:Laminin_G_3 128 283 6.5e-16 PFAM
LamNT 310 513 6.79e-9 SMART
EGF_Lam 515 569 1.58e-3 SMART
EGF_Lam 572 635 5.69e-10 SMART
EGF_Lam 638 688 4.38e-11 SMART
EGF_Lam 691 741 3.56e-11 SMART
EGF_Lam 744 789 7.93e-9 SMART
EGF_Lam 792 841 3.37e-12 SMART
EGF_Lam 844 894 2.01e-10 SMART
EGF_Lam 897 945 5.43e-16 SMART
EGF_Lam 948 996 7.88e-4 SMART
EGF_Lam 999 1047 2.96e-8 SMART
FN3 1051 1130 1e-1 SMART
FN3 1145 1224 2.06e-3 SMART
FN3 1239 1342 8.69e-11 SMART
FN3 1356 1447 5.32e-6 SMART
FN3 1461 1570 2.63e1 SMART
LamG 1531 1672 5.39e-19 SMART
LamG 1727 1862 2.33e-23 SMART
FN3 1861 1931 9.15e1 SMART
FN3 1945 2032 2.24e-4 SMART
FN3 2047 2120 1.13e0 SMART
FN3 2134 2218 3.4e-4 SMART
FN3 2232 2306 1.59e-4 SMART
FN3 2320 2412 1.12e-4 SMART
FN3 2423 2510 8.9e-8 SMART
FN3 2524 2600 1.95e-4 SMART
FN3 2612 2701 4.67e-2 SMART
FN3 2715 2792 1.17e-7 SMART
FN3 2809 2902 1.12e-4 SMART
FN3 2913 2997 5.36e-2 SMART
FN3 3011 3089 2.46e-1 SMART
FN3 3101 3477 2.85e1 SMART
FN3 3491 3568 4e-1 SMART
FN3 3582 3659 5.87e-8 SMART
FN3 3673 3750 1.75e-6 SMART
FN3 3764 3845 9.62e-4 SMART
FN3 3859 3943 2.41e-4 SMART
FN3 3954 4044 5.11e-8 SMART
FN3 4058 4133 1.06e0 SMART
FN3 4147 4241 7.87e-9 SMART
FN3 4255 4334 1.15e-1 SMART
FN3 4348 4422 6.39e-9 SMART
FN3 4435 4510 6.91e-5 SMART
FN3 4521 4610 2.28e-5 SMART
FN3 4626 4713 1.71e0 SMART
FN3 4724 4805 1.3e0 SMART
FN3 4817 4909 3.62e-8 SMART
transmembrane domain 5032 5054 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.3%
Validation Efficiency 99% (80/81)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein that contains laminin EGF motifs, a pentaxin domain, and many fibronectin type III motifs. The protein is found in the basement membrane, and may be important in development and homeostasis of the inner ear and retina. Mutations within this gene have been associated with Usher syndrome type IIa and retinitis pigmentosa. Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Dec 2008]
PHENOTYPE: Mice homozygous for a knock-out allele display progressive retinal photoreceptor degeneration along with significantly reduced a- and b-wave amplitudes, and a moderate but nonprogressive high-frequency hearing loss associated with widespread loss of outer hair cells in the basal turn of the cochlea. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 81 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acaca A G 11: 84,153,300 (GRCm39) T903A probably benign Het
Acin1 A T 14: 54,902,356 (GRCm39) S479T possibly damaging Het
Actr6 A T 10: 89,548,374 (GRCm39) D370E probably benign Het
Adgrl3 T C 5: 81,872,069 (GRCm39) F921S probably damaging Het
Ankmy1 A T 1: 92,814,546 (GRCm39) H320Q possibly damaging Het
Arhgef5 C T 6: 43,250,166 (GRCm39) Q306* probably null Het
Art4 A T 6: 136,831,547 (GRCm39) V198E probably benign Het
Asph G A 4: 9,474,917 (GRCm39) R686W probably damaging Het
Atg7 A G 6: 114,754,018 (GRCm39) H724R probably damaging Het
BC034090 A G 1: 155,117,680 (GRCm39) V146A probably damaging Het
Bcl2a1d T A 9: 88,613,639 (GRCm39) Q45L probably damaging Het
Bmal1 T A 7: 112,884,349 (GRCm39) M122K probably damaging Het
Cd28 G T 1: 60,802,332 (GRCm39) E84* probably null Het
Ceacam3 G A 7: 16,892,163 (GRCm39) W302* probably null Het
Cerkl T C 2: 79,163,934 (GRCm39) N462S probably benign Het
Cisd2 A T 3: 135,116,974 (GRCm39) L39H probably damaging Het
Col11a1 C A 3: 113,883,806 (GRCm39) T225K unknown Het
Col15a1 A T 4: 47,307,752 (GRCm39) Y1178F possibly damaging Het
Cul4a T C 8: 13,192,991 (GRCm39) S630P probably damaging Het
Cyp2c38 T A 19: 39,390,220 (GRCm39) I327F probably damaging Het
Cyp3a25 A C 5: 145,928,257 (GRCm39) S263A probably benign Het
Cyp3a25 T A 5: 145,939,868 (GRCm39) L46F probably benign Het
Dmrta1 T A 4: 89,580,408 (GRCm39) L456* probably null Het
Dnah12 T C 14: 26,536,579 (GRCm39) L2165P probably benign Het
Dsg1a C A 18: 20,461,368 (GRCm39) S253R probably damaging Het
Egln2 A C 7: 26,859,744 (GRCm39) I323S probably damaging Het
Fam171b A G 2: 83,708,574 (GRCm39) T359A probably damaging Het
Fcgr2b G T 1: 170,790,966 (GRCm39) Q276K probably benign Het
Fcrl2 C T 3: 87,159,934 (GRCm39) C440Y probably damaging Het
Fmnl2 T C 2: 52,963,666 (GRCm39) V266A unknown Het
Glo1 A T 17: 30,816,828 (GRCm39) D109E probably benign Het
Grin3b A G 10: 79,809,912 (GRCm39) R473G possibly damaging Het
Ica1 G A 6: 8,644,015 (GRCm39) L425F probably damaging Het
Iho1 A T 9: 108,281,974 (GRCm39) D571E probably damaging Het
Ilrun A C 17: 28,013,044 (GRCm39) probably null Het
Kcnq5 T C 1: 21,473,099 (GRCm39) E716G possibly damaging Het
Klra17 A T 6: 129,850,306 (GRCm39) I48K possibly damaging Het
Lrrc66 G T 5: 73,787,240 (GRCm39) Q37K probably benign Het
Ly6a T A 15: 74,868,325 (GRCm39) T55S probably benign Het
Lyst T A 13: 13,883,885 (GRCm39) Y2924* probably null Het
Lyzl6 A G 11: 103,522,177 (GRCm39) Y140H probably benign Het
Mak T C 13: 41,204,916 (GRCm39) I141V possibly damaging Het
Mapk7 A G 11: 61,379,998 (GRCm39) I789T probably benign Het
Mgat4f A G 1: 134,318,206 (GRCm39) D326G possibly damaging Het
Mrpl4 T C 9: 20,918,634 (GRCm39) I123T probably benign Het
Mup18 G C 4: 61,591,573 (GRCm39) probably null Het
Myef2 T C 2: 124,938,082 (GRCm39) probably null Het
Myh7 T C 14: 55,228,402 (GRCm39) T235A possibly damaging Het
Myo18b C T 5: 112,863,325 (GRCm39) C2171Y probably damaging Het
Nat8 A T 6: 85,807,877 (GRCm39) Y85* probably null Het
Nyap1 A T 5: 137,734,524 (GRCm39) S170T probably damaging Het
Ogfr AGCCAGGTGGGGCCAGAGGACCCCAAAAGCCAGGTGGGGCCAGAGGACCCAAAAGGCCAGGTGGAGCCAGAGGACCCAAAAGGCCAGGTGGGGCCAGAAGACCCAAAAGGCCAGGTGGGGCCAGAGGACCCAAAAGGCCAGGTGGGGCCAGAGGACCCCAAAAGCCAGGTGGGGCCAGAGGACCCCAAAAGCCAGGTGGAGCCAGAGGACCCCAAAAGCCAGGTGGAGCCAGAGGACCCCAAAAGCCAGGTGGAGCCAGAGGACCCCAAAAGCCAGGTGGGGCCAGAGGACCCCCAAAGCCAGGTGGGGCCAGAG AGCCAGGTGGAGCCAGAGGACCCAAAAGGCCAGGTGGGGCCAGAAGACCCAAAAGGCCAGGTGGGGCCAGAGGACCCAAAAGGCCAGGTGGGGCCAGAGGACCCCAAAAGCCAGGTGGGGCCAGAGGACCCCAAAAGCCAGGTGGAGCCAGAGGACCCCAAAAGCCAGGTGGAGCCAGAGGACCCCAAAAGCCAGGTGGAGCCAGAGGACCCCAAAAGCCAGGTGGGGCCAGAGGACCCCCAAAGCCAGGTGGGGCCAGAG 2: 180,236,887 (GRCm39) probably benign Het
Or10ah1-ps1 A G 5: 143,123,553 (GRCm39) Y157H probably damaging Het
Or1e32 A G 11: 73,705,167 (GRCm39) V247A probably benign Het
Or51a25 T A 7: 102,373,692 (GRCm39) I2F probably benign Het
Papss1 T C 3: 131,305,687 (GRCm39) L244P probably damaging Het
Pibf1 A T 14: 99,433,844 (GRCm39) D597V probably damaging Het
Pmpcb T A 5: 21,942,177 (GRCm39) M1K probably null Het
Ppwd1 G A 13: 104,343,680 (GRCm39) P575L probably damaging Het
Pramel17 T A 4: 101,695,338 (GRCm39) probably null Het
Prc1 A G 7: 79,960,837 (GRCm39) Q457R possibly damaging Het
Prdm10 T C 9: 31,227,602 (GRCm39) V69A possibly damaging Het
Prkdc A G 16: 15,516,667 (GRCm39) I1014V probably benign Het
Rab3gap2 A G 1: 184,999,388 (GRCm39) Y999C probably damaging Het
Robo3 G A 9: 37,335,626 (GRCm39) Q539* probably null Het
Rps12 A G 10: 23,661,129 (GRCm39) Y127H probably benign Het
Sar1b A G 11: 51,679,079 (GRCm39) D116G probably benign Het
Selenbp2 C T 3: 94,609,664 (GRCm39) P294L probably benign Het
Slc6a2 T C 8: 93,722,300 (GRCm39) Y516H probably damaging Het
Slit2 A G 5: 48,394,627 (GRCm39) N673S probably null Het
Snap91 A T 9: 86,672,199 (GRCm39) probably null Het
Spata31h1 T C 10: 82,127,461 (GRCm39) M1850V probably benign Het
Srpk2 A G 5: 23,712,626 (GRCm39) F653L possibly damaging Het
Supt5 A T 7: 28,016,213 (GRCm39) S824T probably benign Het
Taar7a A G 10: 23,868,358 (GRCm39) V341A probably benign Het
Tmem52 G A 4: 155,554,778 (GRCm39) G134R probably damaging Het
Usp32 GAACAAGTCCACAACAA GAACAA 11: 84,913,681 (GRCm39) probably null Het
Vmn1r173 A T 7: 23,401,583 (GRCm39) probably benign Het
Vmn2r118 G A 17: 55,915,496 (GRCm39) R485* probably null Het
Vwce A G 19: 10,615,479 (GRCm39) E120G possibly damaging Het
Zfp143 T C 7: 109,692,287 (GRCm39) V566A possibly damaging Het
Other mutations in Ush2a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00155:Ush2a APN 1 188,596,875 (GRCm39) missense probably benign 0.00
IGL00391:Ush2a APN 1 188,648,258 (GRCm39) missense probably damaging 1.00
IGL00429:Ush2a APN 1 188,132,311 (GRCm39) nonsense probably null
IGL00484:Ush2a APN 1 188,514,710 (GRCm39) missense probably benign 0.00
IGL00519:Ush2a APN 1 188,176,865 (GRCm39) missense probably benign 0.03
IGL00567:Ush2a APN 1 188,697,114 (GRCm39) missense probably damaging 1.00
IGL00823:Ush2a APN 1 188,643,640 (GRCm39) missense possibly damaging 0.61
IGL00940:Ush2a APN 1 188,090,158 (GRCm39) nonsense probably null
IGL00951:Ush2a APN 1 187,995,662 (GRCm39) missense probably benign 0.33
IGL00956:Ush2a APN 1 188,485,719 (GRCm39) missense probably damaging 0.99
IGL01096:Ush2a APN 1 188,410,574 (GRCm39) missense probably damaging 1.00
IGL01108:Ush2a APN 1 188,595,022 (GRCm39) missense probably benign 0.00
IGL01315:Ush2a APN 1 188,365,811 (GRCm39) missense possibly damaging 0.51
IGL01318:Ush2a APN 1 188,546,550 (GRCm39) missense probably benign 0.00
IGL01324:Ush2a APN 1 188,581,189 (GRCm39) missense probably benign 0.38
IGL01326:Ush2a APN 1 187,995,518 (GRCm39) nonsense probably null
IGL01384:Ush2a APN 1 188,285,425 (GRCm39) missense possibly damaging 0.65
IGL01466:Ush2a APN 1 188,643,819 (GRCm39) missense probably benign 0.00
IGL01518:Ush2a APN 1 188,131,982 (GRCm39) missense probably benign 0.01
IGL01585:Ush2a APN 1 188,162,924 (GRCm39) missense probably damaging 1.00
IGL01595:Ush2a APN 1 188,386,921 (GRCm39) critical splice donor site probably null
IGL01657:Ush2a APN 1 188,558,658 (GRCm39) missense probably benign 0.03
IGL01797:Ush2a APN 1 187,995,706 (GRCm39) missense probably damaging 1.00
IGL01802:Ush2a APN 1 188,169,154 (GRCm39) missense probably damaging 0.99
IGL01836:Ush2a APN 1 188,492,060 (GRCm39) splice site probably benign
IGL01938:Ush2a APN 1 188,530,042 (GRCm39) missense probably damaging 1.00
IGL01976:Ush2a APN 1 188,643,438 (GRCm39) missense probably benign 0.04
IGL02023:Ush2a APN 1 188,465,711 (GRCm39) missense probably benign 0.03
IGL02126:Ush2a APN 1 187,995,588 (GRCm39) missense probably benign 0.01
IGL02133:Ush2a APN 1 188,175,540 (GRCm39) missense probably damaging 1.00
IGL02147:Ush2a APN 1 188,596,900 (GRCm39) missense probably benign
IGL02275:Ush2a APN 1 187,995,466 (GRCm39) missense possibly damaging 0.67
IGL02314:Ush2a APN 1 188,365,826 (GRCm39) missense probably benign 0.00
IGL02353:Ush2a APN 1 188,460,635 (GRCm39) missense probably benign 0.04
IGL02360:Ush2a APN 1 188,460,635 (GRCm39) missense probably benign 0.04
IGL02367:Ush2a APN 1 188,516,943 (GRCm39) missense probably benign
IGL02402:Ush2a APN 1 187,999,305 (GRCm39) missense probably benign 0.02
IGL02410:Ush2a APN 1 188,648,194 (GRCm39) missense probably damaging 1.00
IGL02490:Ush2a APN 1 188,542,561 (GRCm39) missense probably damaging 1.00
IGL02500:Ush2a APN 1 188,554,893 (GRCm39) missense probably damaging 1.00
IGL02511:Ush2a APN 1 188,475,884 (GRCm39) critical splice donor site probably null
IGL02517:Ush2a APN 1 188,648,195 (GRCm39) missense probably damaging 1.00
IGL02536:Ush2a APN 1 188,689,463 (GRCm39) critical splice acceptor site probably null
IGL02585:Ush2a APN 1 188,460,530 (GRCm39) missense probably benign 0.00
IGL02610:Ush2a APN 1 188,176,663 (GRCm39) missense probably damaging 0.98
IGL02677:Ush2a APN 1 188,466,882 (GRCm39) missense probably damaging 1.00
IGL02691:Ush2a APN 1 188,466,949 (GRCm39) missense probably damaging 1.00
IGL02740:Ush2a APN 1 188,380,585 (GRCm39) missense possibly damaging 0.68
IGL02744:Ush2a APN 1 188,090,914 (GRCm39) splice site probably null
IGL02749:Ush2a APN 1 188,679,155 (GRCm39) missense probably damaging 0.99
IGL02806:Ush2a APN 1 188,542,554 (GRCm39) nonsense probably null
IGL02870:Ush2a APN 1 188,410,555 (GRCm39) missense probably benign 0.42
IGL02894:Ush2a APN 1 188,184,043 (GRCm39) missense probably damaging 1.00
IGL02904:Ush2a APN 1 188,638,703 (GRCm39) missense probably benign 0.06
IGL03000:Ush2a APN 1 188,282,053 (GRCm39) missense possibly damaging 0.81
IGL03015:Ush2a APN 1 188,169,147 (GRCm39) missense probably benign 0.01
IGL03036:Ush2a APN 1 188,596,818 (GRCm39) missense possibly damaging 0.80
IGL03057:Ush2a APN 1 188,530,035 (GRCm39) missense probably damaging 1.00
IGL03230:Ush2a APN 1 188,198,390 (GRCm39) missense probably benign 0.09
IGL03278:Ush2a APN 1 188,581,313 (GRCm39) missense probably damaging 1.00
BB003:Ush2a UTSW 1 188,460,797 (GRCm39) missense probably benign
BB013:Ush2a UTSW 1 188,460,797 (GRCm39) missense probably benign
PIT4283001:Ush2a UTSW 1 188,169,064 (GRCm39) missense probably benign 0.01
R0003:Ush2a UTSW 1 188,310,688 (GRCm39) missense probably damaging 0.99
R0030:Ush2a UTSW 1 188,554,854 (GRCm39) missense possibly damaging 0.51
R0035:Ush2a UTSW 1 188,089,085 (GRCm39) missense probably benign
R0038:Ush2a UTSW 1 188,358,809 (GRCm39) missense probably benign 0.00
R0038:Ush2a UTSW 1 188,358,809 (GRCm39) missense probably benign 0.00
R0067:Ush2a UTSW 1 188,697,043 (GRCm39) missense probably damaging 0.99
R0067:Ush2a UTSW 1 188,697,043 (GRCm39) missense probably damaging 0.99
R0103:Ush2a UTSW 1 188,051,267 (GRCm39) missense possibly damaging 0.81
R0103:Ush2a UTSW 1 188,051,267 (GRCm39) missense possibly damaging 0.81
R0122:Ush2a UTSW 1 188,680,652 (GRCm39) missense possibly damaging 0.65
R0206:Ush2a UTSW 1 188,263,958 (GRCm39) missense probably damaging 0.99
R0208:Ush2a UTSW 1 188,263,958 (GRCm39) missense probably damaging 0.99
R0230:Ush2a UTSW 1 188,582,301 (GRCm39) missense probably damaging 1.00
R0269:Ush2a UTSW 1 188,542,373 (GRCm39) missense probably benign 0.33
R0319:Ush2a UTSW 1 188,680,571 (GRCm39) splice site probably benign
R0358:Ush2a UTSW 1 188,269,977 (GRCm39) missense possibly damaging 0.83
R0379:Ush2a UTSW 1 188,184,016 (GRCm39) missense probably damaging 1.00
R0427:Ush2a UTSW 1 188,132,478 (GRCm39) missense probably damaging 1.00
R0437:Ush2a UTSW 1 188,643,228 (GRCm39) missense probably benign 0.00
R0462:Ush2a UTSW 1 188,643,136 (GRCm39) missense probably benign
R0510:Ush2a UTSW 1 188,466,860 (GRCm39) splice site probably benign
R0531:Ush2a UTSW 1 188,175,378 (GRCm39) missense probably benign 0.18
R0541:Ush2a UTSW 1 188,446,663 (GRCm39) splice site probably benign
R0549:Ush2a UTSW 1 188,679,150 (GRCm39) missense probably damaging 0.99
R0562:Ush2a UTSW 1 188,089,044 (GRCm39) missense probably damaging 1.00
R0636:Ush2a UTSW 1 188,554,935 (GRCm39) missense probably benign
R0662:Ush2a UTSW 1 188,083,290 (GRCm39) missense probably benign 0.26
R0685:Ush2a UTSW 1 188,132,475 (GRCm39) missense probably damaging 1.00
R0718:Ush2a UTSW 1 188,530,027 (GRCm39) missense probably damaging 1.00
R0725:Ush2a UTSW 1 188,683,722 (GRCm39) missense probably damaging 1.00
R0735:Ush2a UTSW 1 188,596,890 (GRCm39) missense probably benign 0.04
R0744:Ush2a UTSW 1 188,546,603 (GRCm39) splice site probably benign
R0765:Ush2a UTSW 1 188,680,771 (GRCm39) missense possibly damaging 0.67
R0862:Ush2a UTSW 1 188,275,015 (GRCm39) nonsense probably null
R1067:Ush2a UTSW 1 188,282,404 (GRCm39) missense probably benign 0.35
R1072:Ush2a UTSW 1 188,460,914 (GRCm39) missense possibly damaging 0.91
R1099:Ush2a UTSW 1 188,596,836 (GRCm39) missense probably damaging 1.00
R1099:Ush2a UTSW 1 188,380,545 (GRCm39) missense probably benign 0.06
R1104:Ush2a UTSW 1 188,648,453 (GRCm39) missense probably benign
R1106:Ush2a UTSW 1 188,643,180 (GRCm39) missense possibly damaging 0.82
R1124:Ush2a UTSW 1 188,485,733 (GRCm39) missense probably damaging 0.99
R1168:Ush2a UTSW 1 188,410,608 (GRCm39) missense probably benign 0.01
R1199:Ush2a UTSW 1 188,491,992 (GRCm39) missense probably benign 0.00
R1215:Ush2a UTSW 1 188,689,479 (GRCm39) missense possibly damaging 0.66
R1307:Ush2a UTSW 1 188,184,037 (GRCm39) missense probably damaging 1.00
R1307:Ush2a UTSW 1 188,090,164 (GRCm39) missense probably damaging 1.00
R1311:Ush2a UTSW 1 188,679,342 (GRCm39) missense possibly damaging 0.86
R1388:Ush2a UTSW 1 188,255,515 (GRCm39) splice site probably benign
R1416:Ush2a UTSW 1 188,169,080 (GRCm39) missense probably damaging 1.00
R1424:Ush2a UTSW 1 188,275,075 (GRCm39) critical splice donor site probably null
R1459:Ush2a UTSW 1 188,595,048 (GRCm39) missense probably benign 0.05
R1470:Ush2a UTSW 1 188,132,403 (GRCm39) missense probably benign 0.00
R1470:Ush2a UTSW 1 188,132,403 (GRCm39) missense probably benign 0.00
R1477:Ush2a UTSW 1 188,581,273 (GRCm39) missense probably benign 0.05
R1484:Ush2a UTSW 1 188,542,534 (GRCm39) nonsense probably null
R1490:Ush2a UTSW 1 188,092,038 (GRCm39) missense probably benign 0.24
R1510:Ush2a UTSW 1 188,380,501 (GRCm39) missense probably damaging 1.00
R1522:Ush2a UTSW 1 188,530,011 (GRCm39) missense possibly damaging 0.94
R1606:Ush2a UTSW 1 188,491,963 (GRCm39) missense probably benign 0.17
R1618:Ush2a UTSW 1 188,546,421 (GRCm39) missense probably benign 0.29
R1636:Ush2a UTSW 1 188,198,373 (GRCm39) missense possibly damaging 0.53
R1646:Ush2a UTSW 1 188,148,018 (GRCm39) missense probably damaging 1.00
R1660:Ush2a UTSW 1 188,648,261 (GRCm39) missense probably benign
R1676:Ush2a UTSW 1 188,460,782 (GRCm39) missense probably damaging 1.00
R1704:Ush2a UTSW 1 188,553,993 (GRCm39) missense probably damaging 1.00
R1705:Ush2a UTSW 1 188,643,738 (GRCm39) missense probably benign 0.40
R1705:Ush2a UTSW 1 188,607,066 (GRCm39) missense probably damaging 1.00
R1760:Ush2a UTSW 1 188,643,180 (GRCm39) missense possibly damaging 0.82
R1776:Ush2a UTSW 1 188,460,400 (GRCm39) missense possibly damaging 0.83
R1782:Ush2a UTSW 1 188,643,382 (GRCm39) missense probably benign 0.06
R1794:Ush2a UTSW 1 188,595,006 (GRCm39) missense probably benign 0.00
R1796:Ush2a UTSW 1 188,643,024 (GRCm39) missense probably benign 0.11
R1804:Ush2a UTSW 1 188,365,926 (GRCm39) critical splice donor site probably null
R1835:Ush2a UTSW 1 188,184,015 (GRCm39) missense probably benign 0.13
R1871:Ush2a UTSW 1 188,558,665 (GRCm39) missense probably benign 0.02
R1876:Ush2a UTSW 1 188,410,486 (GRCm39) missense possibly damaging 0.51
R1887:Ush2a UTSW 1 188,132,177 (GRCm39) missense probably benign 0.05
R1896:Ush2a UTSW 1 188,282,206 (GRCm39) missense probably benign 0.00
R1907:Ush2a UTSW 1 188,447,261 (GRCm39) missense probably benign 0.01
R1940:Ush2a UTSW 1 188,683,758 (GRCm39) missense probably null 0.89
R1950:Ush2a UTSW 1 188,487,382 (GRCm39) missense probably damaging 1.00
R1991:Ush2a UTSW 1 188,310,729 (GRCm39) splice site probably benign
R2043:Ush2a UTSW 1 188,648,453 (GRCm39) missense probably benign 0.00
R2046:Ush2a UTSW 1 188,089,124 (GRCm39) missense probably benign 0.01
R2059:Ush2a UTSW 1 188,113,746 (GRCm39) critical splice donor site probably null
R2239:Ush2a UTSW 1 188,308,411 (GRCm39) missense probably benign
R2365:Ush2a UTSW 1 188,111,188 (GRCm39) missense possibly damaging 0.68
R2395:Ush2a UTSW 1 188,679,237 (GRCm39) missense probably damaging 1.00
R2425:Ush2a UTSW 1 188,270,001 (GRCm39) missense possibly damaging 0.82
R2519:Ush2a UTSW 1 187,999,304 (GRCm39) missense probably benign
R3039:Ush2a UTSW 1 188,643,744 (GRCm39) missense probably damaging 0.99
R3434:Ush2a UTSW 1 188,465,955 (GRCm39) missense probably damaging 1.00
R3711:Ush2a UTSW 1 188,542,489 (GRCm39) missense probably benign 0.05
R3712:Ush2a UTSW 1 188,542,489 (GRCm39) missense probably benign 0.05
R3732:Ush2a UTSW 1 188,676,957 (GRCm39) missense probably benign 0.16
R3746:Ush2a UTSW 1 188,542,489 (GRCm39) missense probably benign 0.05
R3747:Ush2a UTSW 1 188,542,489 (GRCm39) missense probably benign 0.05
R3883:Ush2a UTSW 1 187,995,579 (GRCm39) missense probably benign
R3911:Ush2a UTSW 1 188,132,151 (GRCm39) missense probably benign 0.05
R3934:Ush2a UTSW 1 187,995,708 (GRCm39) critical splice donor site probably null
R3946:Ush2a UTSW 1 188,460,701 (GRCm39) missense probably benign 0.01
R3974:Ush2a UTSW 1 188,113,698 (GRCm39) missense probably benign 0.06
R4158:Ush2a UTSW 1 188,460,907 (GRCm39) missense probably damaging 1.00
R4159:Ush2a UTSW 1 188,460,907 (GRCm39) missense probably damaging 1.00
R4161:Ush2a UTSW 1 188,460,907 (GRCm39) missense probably damaging 1.00
R4162:Ush2a UTSW 1 188,475,877 (GRCm39) missense probably benign 0.00
R4255:Ush2a UTSW 1 188,492,040 (GRCm39) nonsense probably null
R4280:Ush2a UTSW 1 188,310,658 (GRCm39) missense probably benign 0.16
R4387:Ush2a UTSW 1 188,175,628 (GRCm39) missense probably benign 0.00
R4416:Ush2a UTSW 1 188,089,071 (GRCm39) missense probably damaging 0.97
R4494:Ush2a UTSW 1 188,285,473 (GRCm39) missense possibly damaging 0.50
R4505:Ush2a UTSW 1 188,460,793 (GRCm39) missense possibly damaging 0.92
R4522:Ush2a UTSW 1 188,596,822 (GRCm39) missense probably damaging 1.00
R4584:Ush2a UTSW 1 188,183,995 (GRCm39) missense probably benign 0.00
R4599:Ush2a UTSW 1 188,643,844 (GRCm39) missense probably benign 0.01
R4605:Ush2a UTSW 1 188,642,998 (GRCm39) missense probably damaging 1.00
R4632:Ush2a UTSW 1 188,128,071 (GRCm39) missense possibly damaging 0.82
R4688:Ush2a UTSW 1 188,132,138 (GRCm39) missense probably benign 0.01
R4751:Ush2a UTSW 1 188,582,284 (GRCm39) missense probably damaging 0.98
R4770:Ush2a UTSW 1 188,282,076 (GRCm39) missense probably benign 0.25
R4771:Ush2a UTSW 1 188,529,966 (GRCm39) missense possibly damaging 0.92
R4798:Ush2a UTSW 1 188,475,742 (GRCm39) missense probably damaging 1.00
R4821:Ush2a UTSW 1 188,485,848 (GRCm39) missense probably benign 0.32
R4857:Ush2a UTSW 1 188,269,917 (GRCm39) missense probably benign 0.01
R4860:Ush2a UTSW 1 188,285,472 (GRCm39) missense probably benign 0.07
R4860:Ush2a UTSW 1 188,285,472 (GRCm39) missense probably benign 0.07
R4898:Ush2a UTSW 1 188,358,805 (GRCm39) missense probably benign 0.37
R4993:Ush2a UTSW 1 188,642,917 (GRCm39) missense probably benign 0.03
R5035:Ush2a UTSW 1 188,643,005 (GRCm39) missense probably damaging 1.00
R5061:Ush2a UTSW 1 188,689,471 (GRCm39) missense probably benign 0.03
R5150:Ush2a UTSW 1 188,184,067 (GRCm39) missense possibly damaging 0.95
R5205:Ush2a UTSW 1 188,607,133 (GRCm39) missense probably benign 0.21
R5212:Ush2a UTSW 1 188,176,902 (GRCm39) critical splice donor site probably null
R5252:Ush2a UTSW 1 188,553,914 (GRCm39) missense possibly damaging 0.83
R5260:Ush2a UTSW 1 188,679,276 (GRCm39) missense possibly damaging 0.95
R5304:Ush2a UTSW 1 188,088,995 (GRCm39) missense probably damaging 0.99
R5323:Ush2a UTSW 1 188,553,874 (GRCm39) critical splice acceptor site probably null
R5330:Ush2a UTSW 1 188,460,578 (GRCm39) missense probably benign 0.00
R5331:Ush2a UTSW 1 188,460,578 (GRCm39) missense probably benign 0.00
R5332:Ush2a UTSW 1 188,083,276 (GRCm39) missense probably damaging 1.00
R5371:Ush2a UTSW 1 188,175,267 (GRCm39) missense probably benign 0.00
R5374:Ush2a UTSW 1 188,487,403 (GRCm39) missense probably benign
R5377:Ush2a UTSW 1 188,644,320 (GRCm39) missense probably benign 0.00
R5525:Ush2a UTSW 1 188,485,803 (GRCm39) missense probably benign 0.01
R5558:Ush2a UTSW 1 188,530,024 (GRCm39) missense possibly damaging 0.47
R5562:Ush2a UTSW 1 188,308,414 (GRCm39) missense probably damaging 1.00
R5595:Ush2a UTSW 1 188,638,695 (GRCm39) missense possibly damaging 0.95
R5620:Ush2a UTSW 1 188,492,020 (GRCm39) missense possibly damaging 0.82
R5714:Ush2a UTSW 1 188,132,454 (GRCm39) missense probably benign 0.00
R5743:Ush2a UTSW 1 188,169,159 (GRCm39) missense probably benign 0.01
R5779:Ush2a UTSW 1 188,175,707 (GRCm39) critical splice donor site probably null
R5795:Ush2a UTSW 1 188,175,594 (GRCm39) missense probably benign 0.34
R5897:Ush2a UTSW 1 188,553,935 (GRCm39) missense probably damaging 1.00
R5918:Ush2a UTSW 1 188,089,011 (GRCm39) missense probably benign 0.26
R6000:Ush2a UTSW 1 187,999,223 (GRCm39) nonsense probably null
R6014:Ush2a UTSW 1 188,582,237 (GRCm39) missense probably damaging 0.98
R6017:Ush2a UTSW 1 188,689,711 (GRCm39) critical splice donor site probably null
R6020:Ush2a UTSW 1 188,460,293 (GRCm39) splice site probably null
R6039:Ush2a UTSW 1 188,051,217 (GRCm39) missense possibly damaging 0.76
R6039:Ush2a UTSW 1 188,051,217 (GRCm39) missense possibly damaging 0.76
R6050:Ush2a UTSW 1 188,689,521 (GRCm39) missense probably benign 0.06
R6083:Ush2a UTSW 1 187,999,220 (GRCm39) missense probably damaging 1.00
R6091:Ush2a UTSW 1 188,132,000 (GRCm39) missense probably damaging 1.00
R6120:Ush2a UTSW 1 188,090,800 (GRCm39) missense probably benign 0.04
R6135:Ush2a UTSW 1 188,644,303 (GRCm39) missense possibly damaging 0.68
R6141:Ush2a UTSW 1 188,090,160 (GRCm39) missense possibly damaging 0.71
R6157:Ush2a UTSW 1 188,460,467 (GRCm39) missense probably benign 0.00
R6180:Ush2a UTSW 1 188,132,068 (GRCm39) nonsense probably null
R6191:Ush2a UTSW 1 187,995,298 (GRCm39) nonsense probably null
R6217:Ush2a UTSW 1 188,475,651 (GRCm39) splice site probably null
R6263:Ush2a UTSW 1 188,090,839 (GRCm39) missense probably damaging 1.00
R6294:Ush2a UTSW 1 188,268,567 (GRCm39) missense possibly damaging 0.49
R6320:Ush2a UTSW 1 188,089,043 (GRCm39) missense probably benign 0.01
R6321:Ush2a UTSW 1 188,581,243 (GRCm39) nonsense probably null
R6347:Ush2a UTSW 1 188,643,084 (GRCm39) missense probably benign
R6382:Ush2a UTSW 1 188,546,499 (GRCm39) missense probably benign 0.01
R6408:Ush2a UTSW 1 187,999,229 (GRCm39) nonsense probably null
R6418:Ush2a UTSW 1 188,360,763 (GRCm39) missense probably damaging 1.00
R6500:Ush2a UTSW 1 188,573,724 (GRCm39) missense probably benign 0.00
R6504:Ush2a UTSW 1 188,643,444 (GRCm39) missense probably benign 0.00
R6534:Ush2a UTSW 1 188,183,999 (GRCm39) nonsense probably null
R6594:Ush2a UTSW 1 188,642,995 (GRCm39) missense possibly damaging 0.93
R6612:Ush2a UTSW 1 188,643,594 (GRCm39) missense possibly damaging 0.91
R6645:Ush2a UTSW 1 188,255,528 (GRCm39) missense probably damaging 0.99
R6658:Ush2a UTSW 1 188,546,556 (GRCm39) missense possibly damaging 0.95
R6726:Ush2a UTSW 1 188,485,881 (GRCm39) missense possibly damaging 0.85
R6755:Ush2a UTSW 1 188,175,416 (GRCm39) missense possibly damaging 0.95
R6782:Ush2a UTSW 1 188,089,031 (GRCm39) missense probably benign
R6817:Ush2a UTSW 1 188,595,061 (GRCm39) missense probably benign 0.03
R6834:Ush2a UTSW 1 188,088,989 (GRCm39) missense probably damaging 1.00
R6851:Ush2a UTSW 1 188,265,402 (GRCm39) missense probably benign 0.06
R6853:Ush2a UTSW 1 188,643,434 (GRCm39) nonsense probably null
R6867:Ush2a UTSW 1 188,643,170 (GRCm39) missense probably damaging 1.00
R6889:Ush2a UTSW 1 188,530,068 (GRCm39) missense probably damaging 1.00
R6931:Ush2a UTSW 1 188,460,580 (GRCm39) missense probably benign 0.01
R6953:Ush2a UTSW 1 187,995,342 (GRCm39) missense possibly damaging 0.94
R6966:Ush2a UTSW 1 188,308,441 (GRCm39) missense probably damaging 1.00
R7109:Ush2a UTSW 1 188,113,681 (GRCm39) missense probably benign 0.19
R7153:Ush2a UTSW 1 188,460,681 (GRCm39) missense possibly damaging 0.93
R7176:Ush2a UTSW 1 188,269,925 (GRCm39) missense probably benign 0.00
R7182:Ush2a UTSW 1 188,485,740 (GRCm39) missense probably benign 0.01
R7223:Ush2a UTSW 1 188,542,414 (GRCm39) missense probably benign 0.09
R7231:Ush2a UTSW 1 188,491,960 (GRCm39) missense possibly damaging 0.49
R7240:Ush2a UTSW 1 188,643,858 (GRCm39) missense possibly damaging 0.83
R7263:Ush2a UTSW 1 188,175,526 (GRCm39) missense possibly damaging 0.94
R7329:Ush2a UTSW 1 188,285,395 (GRCm39) missense probably damaging 0.97
R7343:Ush2a UTSW 1 188,147,943 (GRCm39) missense probably benign 0.00
R7352:Ush2a UTSW 1 188,198,321 (GRCm39) missense probably benign 0.04
R7384:Ush2a UTSW 1 188,132,360 (GRCm39) missense probably damaging 0.99
R7391:Ush2a UTSW 1 188,694,205 (GRCm39) small deletion probably benign
R7394:Ush2a UTSW 1 188,643,613 (GRCm39) missense possibly damaging 0.83
R7403:Ush2a UTSW 1 188,365,924 (GRCm39) missense probably damaging 1.00
R7408:Ush2a UTSW 1 188,465,726 (GRCm39) missense probably benign 0.00
R7453:Ush2a UTSW 1 188,285,308 (GRCm39) missense probably damaging 1.00
R7496:Ush2a UTSW 1 188,083,284 (GRCm39) missense possibly damaging 0.50
R7552:Ush2a UTSW 1 187,999,241 (GRCm39) missense possibly damaging 0.65
R7556:Ush2a UTSW 1 188,689,690 (GRCm39) missense probably benign 0.31
R7575:Ush2a UTSW 1 188,554,885 (GRCm39) missense possibly damaging 0.90
R7578:Ush2a UTSW 1 188,282,110 (GRCm39) missense probably damaging 1.00
R7584:Ush2a UTSW 1 188,460,306 (GRCm39) critical splice acceptor site probably null
R7589:Ush2a UTSW 1 188,275,046 (GRCm39) missense probably benign 0.00
R7602:Ush2a UTSW 1 188,380,606 (GRCm39) missense probably damaging 1.00
R7670:Ush2a UTSW 1 188,516,905 (GRCm39) missense possibly damaging 0.78
R7743:Ush2a UTSW 1 188,542,376 (GRCm39) missense probably benign 0.05
R7753:Ush2a UTSW 1 188,175,603 (GRCm39) missense probably benign 0.28
R7767:Ush2a UTSW 1 188,285,457 (GRCm39) missense probably benign 0.01
R7784:Ush2a UTSW 1 188,176,789 (GRCm39) missense possibly damaging 0.55
R7831:Ush2a UTSW 1 188,492,038 (GRCm39) missense probably damaging 0.98
R7834:Ush2a UTSW 1 188,465,637 (GRCm39) nonsense probably null
R7847:Ush2a UTSW 1 188,163,005 (GRCm39) missense probably damaging 1.00
R7926:Ush2a UTSW 1 188,460,797 (GRCm39) missense probably benign
R7969:Ush2a UTSW 1 188,558,568 (GRCm39) missense probably benign 0.02
R7978:Ush2a UTSW 1 188,132,135 (GRCm39) missense probably benign 0.00
R7990:Ush2a UTSW 1 188,274,996 (GRCm39) missense probably benign 0.00
R8001:Ush2a UTSW 1 188,643,261 (GRCm39) missense probably damaging 0.98
R8039:Ush2a UTSW 1 188,689,570 (GRCm39) missense probably damaging 1.00
R8077:Ush2a UTSW 1 188,275,025 (GRCm39) missense probably benign 0.01
R8165:Ush2a UTSW 1 188,183,952 (GRCm39) missense possibly damaging 0.70
R8208:Ush2a UTSW 1 188,606,990 (GRCm39) missense possibly damaging 0.95
R8220:Ush2a UTSW 1 188,460,863 (GRCm39) missense probably damaging 1.00
R8270:Ush2a UTSW 1 188,176,838 (GRCm39) missense probably benign 0.06
R8316:Ush2a UTSW 1 188,178,899 (GRCm39) missense probably benign 0.01
R8347:Ush2a UTSW 1 188,679,281 (GRCm39) missense probably benign 0.02
R8360:Ush2a UTSW 1 188,198,468 (GRCm39) missense probably benign 0.01
R8362:Ush2a UTSW 1 188,689,650 (GRCm39) missense probably damaging 0.96
R8386:Ush2a UTSW 1 188,460,403 (GRCm39) missense possibly damaging 0.80
R8401:Ush2a UTSW 1 188,275,062 (GRCm39) missense probably benign 0.10
R8439:Ush2a UTSW 1 188,582,254 (GRCm39) missense probably damaging 1.00
R8465:Ush2a UTSW 1 188,147,875 (GRCm39) missense probably damaging 1.00
R8478:Ush2a UTSW 1 188,175,429 (GRCm39) missense possibly damaging 0.83
R8540:Ush2a UTSW 1 188,274,858 (GRCm39) missense probably benign 0.00
R8684:Ush2a UTSW 1 188,643,220 (GRCm39) missense possibly damaging 0.45
R8685:Ush2a UTSW 1 188,198,401 (GRCm39) missense probably damaging 1.00
R8699:Ush2a UTSW 1 188,643,574 (GRCm39) missense probably damaging 1.00
R8720:Ush2a UTSW 1 188,090,715 (GRCm39) missense probably benign 0.05
R8754:Ush2a UTSW 1 188,581,162 (GRCm39) nonsense probably null
R8756:Ush2a UTSW 1 188,644,141 (GRCm39) missense possibly damaging 0.91
R8788:Ush2a UTSW 1 188,475,816 (GRCm39) nonsense probably null
R8803:Ush2a UTSW 1 188,676,998 (GRCm39) missense probably benign
R8817:Ush2a UTSW 1 187,995,231 (GRCm39) start codon destroyed probably benign 0.00
R8837:Ush2a UTSW 1 188,485,847 (GRCm39) missense probably benign
R8880:Ush2a UTSW 1 188,460,733 (GRCm39) missense probably benign 0.11
R8902:Ush2a UTSW 1 188,175,281 (GRCm39) missense probably damaging 0.98
R8918:Ush2a UTSW 1 188,270,017 (GRCm39) missense possibly damaging 0.85
R8940:Ush2a UTSW 1 188,132,505 (GRCm39) missense probably benign 0.02
R8968:Ush2a UTSW 1 188,127,956 (GRCm39) missense probably damaging 1.00
R8995:Ush2a UTSW 1 188,176,850 (GRCm39) missense probably damaging 0.98
R9011:Ush2a UTSW 1 188,638,676 (GRCm39) missense probably damaging 0.99
R9037:Ush2a UTSW 1 187,995,487 (GRCm39) missense possibly damaging 0.51
R9063:Ush2a UTSW 1 187,995,457 (GRCm39) missense probably benign 0.00
R9089:Ush2a UTSW 1 188,487,374 (GRCm39) nonsense probably null
R9096:Ush2a UTSW 1 188,198,333 (GRCm39) missense probably benign 0.00
R9118:Ush2a UTSW 1 188,386,839 (GRCm39) missense probably damaging 0.98
R9174:Ush2a UTSW 1 188,460,416 (GRCm39) missense probably damaging 0.99
R9210:Ush2a UTSW 1 188,516,866 (GRCm39) missense probably null 0.01
R9242:Ush2a UTSW 1 188,365,787 (GRCm39) missense probably damaging 1.00
R9321:Ush2a UTSW 1 188,089,148 (GRCm39) missense probably damaging 0.97
R9338:Ush2a UTSW 1 188,308,489 (GRCm39) critical splice donor site probably null
R9357:Ush2a UTSW 1 188,607,147 (GRCm39) missense probably benign 0.01
R9358:Ush2a UTSW 1 188,607,147 (GRCm39) missense probably benign 0.01
R9406:Ush2a UTSW 1 187,995,646 (GRCm39) missense probably benign 0.00
R9407:Ush2a UTSW 1 188,644,045 (GRCm39) missense probably damaging 1.00
R9428:Ush2a UTSW 1 188,175,316 (GRCm39) missense probably damaging 1.00
R9456:Ush2a UTSW 1 188,558,589 (GRCm39) missense probably benign 0.00
R9507:Ush2a UTSW 1 188,596,937 (GRCm39) nonsense probably null
R9509:Ush2a UTSW 1 188,648,440 (GRCm39) missense probably damaging 1.00
R9512:Ush2a UTSW 1 188,643,160 (GRCm39) missense probably damaging 0.99
R9564:Ush2a UTSW 1 188,268,551 (GRCm39) missense possibly damaging 0.90
R9612:Ush2a UTSW 1 188,092,063 (GRCm39) nonsense probably null
R9670:Ush2a UTSW 1 188,360,768 (GRCm39) missense probably benign 0.03
R9684:Ush2a UTSW 1 188,132,078 (GRCm39) missense possibly damaging 0.67
R9798:Ush2a UTSW 1 188,644,002 (GRCm39) missense possibly damaging 0.80
RF017:Ush2a UTSW 1 187,995,666 (GRCm39) missense probably damaging 1.00
U24488:Ush2a UTSW 1 188,162,963 (GRCm39) missense probably damaging 0.99
X0011:Ush2a UTSW 1 188,051,166 (GRCm39) missense probably benign 0.00
X0024:Ush2a UTSW 1 188,132,479 (GRCm39) missense probably damaging 1.00
X0026:Ush2a UTSW 1 188,051,222 (GRCm39) missense possibly damaging 0.94
X0062:Ush2a UTSW 1 188,282,051 (GRCm39) missense probably damaging 1.00
Y4340:Ush2a UTSW 1 188,475,826 (GRCm39) missense possibly damaging 0.87
Y4341:Ush2a UTSW 1 188,475,826 (GRCm39) missense possibly damaging 0.87
Z1088:Ush2a UTSW 1 188,679,201 (GRCm39) missense probably benign 0.26
Z1088:Ush2a UTSW 1 188,644,180 (GRCm39) missense probably benign
Z1176:Ush2a UTSW 1 188,089,038 (GRCm39) missense probably damaging 1.00
Z1177:Ush2a UTSW 1 188,644,407 (GRCm39) missense possibly damaging 0.77
Z1177:Ush2a UTSW 1 188,465,741 (GRCm39) missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- AAGCTGTGTCTGGGTGTCAC -3'
(R):5'- TTACCGTCACCGTGAAAGC -3'

Sequencing Primer
(F):5'- CACGTGGCTTGCTTGGTTC -3'
(R):5'- ATGCACGGTAGAACTGCC -3'
Posted On 2019-06-26