Incidental Mutation 'R7201:Arntl'
ID560309
Institutional Source Beutler Lab
Gene Symbol Arntl
Ensembl Gene ENSMUSG00000055116
Gene Namearyl hydrocarbon receptor nuclear translocator-like
SynonymsBmal1, MOP3, bHLHe5, Arnt3
MMRRC Submission
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.645) question?
Stock #R7201 (G1)
Quality Score225.009
Status Validated
Chromosome7
Chromosomal Location113207465-113314126 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 113285142 bp
ZygosityHeterozygous
Amino Acid Change Methionine to Lysine at position 122 (M122K)
Ref Sequence ENSEMBL: ENSMUSP00000046235 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000047321] [ENSMUST00000210074] [ENSMUST00000210238] [ENSMUST00000211770]
Predicted Effect probably damaging
Transcript: ENSMUST00000047321
AA Change: M122K

PolyPhen 2 Score 0.995 (Sensitivity: 0.68; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000046235
Gene: ENSMUSG00000055116
AA Change: M122K

DomainStartEndE-ValueType
HLH 78 131 2.92e-16 SMART
PAS 146 213 4.41e-12 SMART
PAS 328 394 1.66e-7 SMART
PAC 401 444 2.92e-3 SMART
low complexity region 511 521 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000210074
AA Change: M109K

PolyPhen 2 Score 0.981 (Sensitivity: 0.75; Specificity: 0.96)
Predicted Effect probably damaging
Transcript: ENSMUST00000210238
AA Change: M122K

PolyPhen 2 Score 0.995 (Sensitivity: 0.68; Specificity: 0.97)
Predicted Effect probably damaging
Transcript: ENSMUST00000211770
AA Change: M129K

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.3%
Validation Efficiency 99% (80/81)
MGI Phenotype FUNCTION: The protein encoded by this gene is a basic helix-loop-helix protein that forms a heterodimer with Clock. This heterodimer binds E-box enhancer elements upstream of Period (Per1, Per2, Per3) and Cryptochrome (Cry1, Cry2) genes and activates transcription of these genes. Per and Cry proteins heterodimerize and repress their own transcription by interacting in a feedback loop with Clock/Arntl complexes. Defects in this gene have been linked to infertility, problems with gluconeogenesis and lipogenesis, and altered sleep patterns. Two transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jan 2014]
PHENOTYPE: Homozygous mutation of this gene results in abnormal light/dark cycle activity and decreases overall activity levels. Mice homozygous for another knock-out allele exhibit loss of circadian rhythm in locomotor activity, dyslipidemia, ectopic fat formationand altered energy homeostasis. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 81 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4932415D10Rik T C 10: 82,291,627 M1850V probably benign Het
4933406M09Rik A G 1: 134,390,468 D326G possibly damaging Het
Acaca A G 11: 84,262,474 T903A probably benign Het
Acin1 A T 14: 54,664,899 S479T possibly damaging Het
Actr6 A T 10: 89,712,512 D370E probably benign Het
Adgrl3 T C 5: 81,724,222 F921S probably damaging Het
Ankmy1 A T 1: 92,886,824 H320Q possibly damaging Het
Arhgef5 C T 6: 43,273,232 Q306* probably null Het
Art4 A T 6: 136,854,549 V198E probably benign Het
Asph G A 4: 9,474,917 R686W probably damaging Het
Atg7 A G 6: 114,777,057 H724R probably damaging Het
B020004J07Rik T A 4: 101,838,141 probably null Het
BC034090 A G 1: 155,241,934 V146A probably damaging Het
Bcl2a1d T A 9: 88,731,586 Q45L probably damaging Het
Ccdc36 A T 9: 108,404,775 D571E probably damaging Het
Cd28 G T 1: 60,763,173 E84* probably null Het
Ceacam3 G A 7: 17,158,238 W302* probably null Het
Cerkl T C 2: 79,333,590 N462S probably benign Het
Cisd2 A T 3: 135,411,213 L39H probably damaging Het
Col11a1 C A 3: 114,090,157 T225K unknown Het
Col15a1 A T 4: 47,307,752 Y1178F possibly damaging Het
Cul4a T C 8: 13,142,991 S630P probably damaging Het
Cyp2c38 T A 19: 39,401,776 I327F probably damaging Het
Cyp3a25 A C 5: 145,991,447 S263A probably benign Het
Cyp3a25 T A 5: 146,003,058 L46F probably benign Het
D17Wsu92e A C 17: 27,794,070 probably null Het
Dmrta1 T A 4: 89,692,171 L456* probably null Het
Dnah12 T C 14: 26,814,622 L2165P probably benign Het
Dsg1a C A 18: 20,328,311 S253R probably damaging Het
Egln2 A C 7: 27,160,319 I323S probably damaging Het
Fam171b A G 2: 83,878,230 T359A probably damaging Het
Fcgr2b G T 1: 170,963,397 Q276K probably benign Het
Fcrls C T 3: 87,252,627 C440Y probably damaging Het
Fmnl2 T C 2: 53,073,654 V266A unknown Het
Glo1 A T 17: 30,597,854 D109E probably benign Het
Grin3b A G 10: 79,974,078 R473G possibly damaging Het
Ica1 G A 6: 8,644,015 L425F probably damaging Het
Kcnq5 T C 1: 21,402,875 E716G possibly damaging Het
Klra17 A T 6: 129,873,343 I48K possibly damaging Het
Lrrc66 G T 5: 73,629,897 Q37K probably benign Het
Ly6a T A 15: 74,996,476 T55S probably benign Het
Lyst T A 13: 13,709,300 Y2924* probably null Het
Lyzl6 A G 11: 103,631,351 Y140H probably benign Het
Mak T C 13: 41,051,440 I141V possibly damaging Het
Mapk7 A G 11: 61,489,172 I789T probably benign Het
Mrpl4 T C 9: 21,007,338 I123T probably benign Het
Mup18 G C 4: 61,673,336 probably null Het
Myef2 T C 2: 125,096,162 probably null Het
Myh7 T C 14: 54,990,945 T235A possibly damaging Het
Myo18b C T 5: 112,715,459 C2171Y probably damaging Het
Nat8 A T 6: 85,830,895 Y85* probably null Het
Nyap1 A T 5: 137,736,262 S170T probably damaging Het
Ogfr AGCCAGGTGGGGCCAGAGGACCCCAAAAGCCAGGTGGGGCCAGAGGACCCAAAAGGCCAGGTGGAGCCAGAGGACCCAAAAGGCCAGGTGGGGCCAGAAGACCCAAAAGGCCAGGTGGGGCCAGAGGACCCAAAAGGCCAGGTGGGGCCAGAGGACCCCAAAAGCCAGGTGGGGCCAGAGGACCCCAAAAGCCAGGTGGAGCCAGAGGACCCCAAAAGCCAGGTGGAGCCAGAGGACCCCAAAAGCCAGGTGGAGCCAGAGGACCCCAAAAGCCAGGTGGGGCCAGAGGACCCCCAAAGCCAGGTGGGGCCAGAG AGCCAGGTGGAGCCAGAGGACCCAAAAGGCCAGGTGGGGCCAGAAGACCCAAAAGGCCAGGTGGGGCCAGAGGACCCAAAAGGCCAGGTGGGGCCAGAGGACCCCAAAAGCCAGGTGGGGCCAGAGGACCCCAAAAGCCAGGTGGAGCCAGAGGACCCCAAAAGCCAGGTGGAGCCAGAGGACCCCAAAAGCCAGGTGGAGCCAGAGGACCCCAAAAGCCAGGTGGGGCCAGAGGACCCCCAAAGCCAGGTGGGGCCAGAG 2: 180,595,094 probably benign Het
Olfr392 A G 11: 73,814,341 V247A probably benign Het
Olfr559 T A 7: 102,724,485 I2F probably benign Het
Olfr718-ps1 A G 5: 143,137,798 Y157H probably damaging Het
Papss1 T C 3: 131,599,926 L244P probably damaging Het
Pibf1 A T 14: 99,196,408 D597V probably damaging Het
Pmpcb T A 5: 21,737,179 M1K probably null Het
Ppwd1 G A 13: 104,207,172 P575L probably damaging Het
Prc1 A G 7: 80,311,089 Q457R possibly damaging Het
Prdm10 T C 9: 31,316,306 V69A possibly damaging Het
Prkdc A G 16: 15,698,803 I1014V probably benign Het
Rab3gap2 A G 1: 185,267,191 Y999C probably damaging Het
Robo3 G A 9: 37,424,330 Q539* probably null Het
Rps12 A G 10: 23,785,231 Y127H probably benign Het
Sar1b A G 11: 51,788,252 D116G probably benign Het
Selenbp2 C T 3: 94,702,357 P294L probably benign Het
Slc6a2 T C 8: 92,995,672 Y516H probably damaging Het
Slit2 A G 5: 48,237,285 N673S probably null Het
Snap91 A T 9: 86,790,146 probably null Het
Srpk2 A G 5: 23,507,628 F653L possibly damaging Het
Supt5 A T 7: 28,316,788 S824T probably benign Het
Taar7a A G 10: 23,992,460 V341A probably benign Het
Tmem52 G A 4: 155,470,321 G134R probably damaging Het
Ush2a A G 1: 188,874,754 T3949A probably benign Het
Usp32 GAACAAGTCCACAACAA GAACAA 11: 85,022,855 probably null Het
Vmn1r173 A T 7: 23,702,158 probably benign Het
Vmn2r118 G A 17: 55,608,496 R485* probably null Het
Vwce A G 19: 10,638,115 E120G possibly damaging Het
Zfp143 T C 7: 110,093,080 V566A possibly damaging Het
Other mutations in Arntl
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01320:Arntl APN 7 113303407 missense probably damaging 0.99
diet UTSW 7 113285031 missense probably damaging 1.00
R0308:Arntl UTSW 7 113291536 missense probably damaging 1.00
R2039:Arntl UTSW 7 113285112 missense probably damaging 1.00
R3548:Arntl UTSW 7 113313545 missense probably damaging 1.00
R4355:Arntl UTSW 7 113303406 missense possibly damaging 0.46
R4718:Arntl UTSW 7 113303361 missense probably damaging 0.98
R4725:Arntl UTSW 7 113304359 missense possibly damaging 0.82
R4776:Arntl UTSW 7 113285037 missense probably damaging 1.00
R4920:Arntl UTSW 7 113285114 missense probably damaging 1.00
R4960:Arntl UTSW 7 113299435 critical splice donor site probably null
R4985:Arntl UTSW 7 113285073 missense probably damaging 1.00
R5640:Arntl UTSW 7 113308681 missense probably damaging 1.00
R5739:Arntl UTSW 7 113285031 missense probably damaging 1.00
R6004:Arntl UTSW 7 113280727 missense probably damaging 0.97
R7214:Arntl UTSW 7 113299403 missense probably benign 0.44
R7218:Arntl UTSW 7 113287183 missense probably damaging 0.96
R7378:Arntl UTSW 7 113299208 missense probably benign 0.44
R7491:Arntl UTSW 7 113299424 missense probably benign 0.43
Predicted Primers PCR Primer
(F):5'- TCGATGCTCGTGTACATCTCAG -3'
(R):5'- CTGGGGAAGTATTAGTGCAAATGAC -3'

Sequencing Primer
(F):5'- GCTCGTGTACATCTCAGATGAATC -3'
(R):5'- TCAGCTCATTAACAACCTGATTCGG -3'
Posted On2019-06-26