Incidental Mutation 'R0592:Rab37'
ID56031
Institutional Source Beutler Lab
Gene Symbol Rab37
Ensembl Gene ENSMUSG00000020732
Gene NameRAB37, member RAS oncogene family
SynonymsB230331O03Rik, B230354I04Rik
MMRRC Submission 038782-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.065) question?
Stock #R0592 (G1)
Quality Score225
Status Validated
Chromosome11
Chromosomal Location115091431-115162236 bp(+) (GRCm38)
Type of Mutationsplice site
DNA Base Change (assembly) T to G at 115160523 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000065016 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000021076] [ENSMUST00000021077] [ENSMUST00000067754]
Predicted Effect probably benign
Transcript: ENSMUST00000021076
SMART Domains Protein: ENSMUSP00000021076
Gene: ENSMUSG00000020732

DomainStartEndE-ValueType
low complexity region 2 17 N/A INTRINSIC
RAB 31 194 9.38e-93 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000021077
SMART Domains Protein: ENSMUSP00000021077
Gene: ENSMUSG00000020733

DomainStartEndE-ValueType
PDZ 22 94 2.9e-20 SMART
PDZ 157 229 6.03e-18 SMART
Pfam:EBP50_C 230 355 1.4e-47 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000067754
SMART Domains Protein: ENSMUSP00000065016
Gene: ENSMUSG00000020732

DomainStartEndE-ValueType
RAB 23 187 1.27e-89 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000156383
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.9%
  • 10x: 97.5%
  • 20x: 95.0%
Validation Efficiency 100% (35/35)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Rab proteins are low molecular mass GTPases that are critical regulators of vesicle trafficking. For additional background information on Rab proteins, see MIM 179508.[supplied by OMIM, Apr 2006]
Allele List at MGI
Other mutations in this stock
Total: 35 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Atg2a GCCTTCCTTCCTTCCTTCCTTCCTTCCTTCCTTCC GCCTTCCTTCCTTCCTTCCTTCCTTCCTTCCTTCCTTCC 19: 6,245,007 probably benign Het
Bbs7 A T 3: 36,610,297 V53D probably benign Het
Bglap T A 3: 88,383,655 I90F probably benign Het
C2cd4b G A 9: 67,760,691 R323H probably damaging Het
Cdh5 T A 8: 104,130,902 probably null Het
Cdh8 T A 8: 99,279,478 D159V probably damaging Het
Dnah7a A G 1: 53,456,612 Y3229H possibly damaging Het
Dzip1 T C 14: 118,902,139 E381G probably damaging Het
Elmod1 A G 9: 53,926,106 probably benign Het
Exosc10 T C 4: 148,581,113 S811P probably benign Het
Fhl3 A G 4: 124,705,677 Y15C probably benign Het
Gstz1 G A 12: 87,163,721 S126N probably benign Het
Hey2 C A 10: 30,833,957 A267S probably benign Het
Iqce A T 5: 140,686,107 probably null Het
Katnal2 A T 18: 77,002,560 probably null Het
Kdm2b G A 5: 122,961,134 probably benign Het
Mov10l1 A G 15: 88,998,766 probably null Het
Numa1 A G 7: 102,013,897 T724A probably benign Het
Oas3 A G 5: 120,771,149 F244S probably damaging Het
Olfr1472 T C 19: 13,453,705 I271V probably benign Het
Olfr715 G A 7: 107,129,343 L17F probably benign Het
Ppil2 A G 16: 17,107,219 S30P probably benign Het
Riox2 T C 16: 59,489,579 probably benign Het
Ryr3 A G 2: 112,678,481 S3358P probably damaging Het
Sash1 T A 10: 8,729,782 H948L probably benign Het
Serpinb6e T A 13: 33,841,074 N78I probably damaging Het
Slc25a47 G A 12: 108,854,258 V63M probably damaging Het
Slc9b1 A T 3: 135,394,074 probably benign Het
Strip2 T A 6: 29,931,210 S387T probably benign Het
Tcaf3 T C 6: 42,596,843 N145S probably benign Het
Tex10 C T 4: 48,456,800 R637Q probably benign Het
Trmu T C 15: 85,896,826 probably benign Het
Vezf1 A T 11: 88,068,435 probably benign Het
Vmn2r116 C T 17: 23,386,915 T267I probably damaging Het
Whrn C A 4: 63,415,567 A450S probably damaging Het
Other mutations in Rab37
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02057:Rab37 APN 11 115160717 missense probably benign 0.00
IGL03278:Rab37 APN 11 115159691 missense possibly damaging 0.59
R0051:Rab37 UTSW 11 115158665 missense probably damaging 1.00
R0360:Rab37 UTSW 11 115156964 missense probably damaging 1.00
R0364:Rab37 UTSW 11 115156964 missense probably damaging 1.00
R0639:Rab37 UTSW 11 115158702 missense probably benign 0.04
R1958:Rab37 UTSW 11 115160351 missense probably damaging 1.00
R4301:Rab37 UTSW 11 115158564 missense possibly damaging 0.53
R5423:Rab37 UTSW 11 115157027 missense possibly damaging 0.63
R6196:Rab37 UTSW 11 115160306 missense probably benign 0.30
R6488:Rab37 UTSW 11 115157963 missense probably benign 0.01
R7539:Rab37 UTSW 11 115160661 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- GCGAAAGGGTGATCCGTTCTGAAG -3'
(R):5'- TTCCCATGATGCAGGGAAGCTAAAG -3'

Sequencing Primer
(F):5'- TCCGTTCTGAAGATGGAGAGAC -3'
(R):5'- TTGGAGTACTGCATCCCCAAG -3'
Posted On2013-07-11