Incidental Mutation 'R0592:Gstz1'
ID56032
Institutional Source Beutler Lab
Gene Symbol Gstz1
Ensembl Gene ENSMUSG00000021033
Gene Nameglutathione transferase zeta 1 (maleylacetoacetate isomerase)
Synonymsmaleylacetoacetate isomerase
MMRRC Submission 038782-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R0592 (G1)
Quality Score107
Status Validated
Chromosome12
Chromosomal Location87147165-87164723 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 87163721 bp
ZygosityHeterozygous
Amino Acid Change Serine to Asparagine at position 126 (S126N)
Ref Sequence ENSEMBL: ENSMUSP00000152343 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000037418] [ENSMUST00000063117] [ENSMUST00000220574] [ENSMUST00000222222] [ENSMUST00000222885]
Predicted Effect probably benign
Transcript: ENSMUST00000037418
SMART Domains Protein: ENSMUSP00000043742
Gene: ENSMUSG00000034111

DomainStartEndE-ValueType
low complexity region 50 65 N/A INTRINSIC
Pfam:GOLD_2 186 325 2.2e-73 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000063117
AA Change: S181N

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000053540
Gene: ENSMUSG00000021033
AA Change: S181N

DomainStartEndE-ValueType
Pfam:GST_N 5 81 4.3e-19 PFAM
Pfam:GST_N_3 8 93 1.2e-18 PFAM
Pfam:GST_N_2 13 82 3.9e-17 PFAM
Pfam:GST_C 99 197 2.5e-6 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000220574
AA Change: S126N

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
Predicted Effect probably benign
Transcript: ENSMUST00000222222
AA Change: S180N

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
Predicted Effect probably benign
Transcript: ENSMUST00000222885
AA Change: S126N

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.9%
  • 10x: 97.5%
  • 20x: 95.0%
Validation Efficiency 100% (35/35)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is a member of the glutathione S-transferase (GSTs) super-family which encodes multifunctional enzymes important in the detoxification of electrophilic molecules, including carcinogens, mutagens, and several therapeutic drugs, by conjugation with glutathione. This enzyme catalyzes the conversion of maleylacetoacetate to fumarylacetoacatate, which is one of the steps in the phenylalanine/tyrosine degradation pathway. Deficiency of a similar gene in mouse causes oxidative stress. Several transcript variants of this gene encode multiple protein isoforms. [provided by RefSeq, Jul 2015]
PHENOTYPE: Mice homozygous for disruptions in this gene have essentially normal phenotypes but do display ketoaciduria and severe sensitivity to diets high in tyrosine or phenylalanine. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 35 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Atg2a GCCTTCCTTCCTTCCTTCCTTCCTTCCTTCCTTCC GCCTTCCTTCCTTCCTTCCTTCCTTCCTTCCTTCCTTCC 19: 6,245,007 probably benign Het
Bbs7 A T 3: 36,610,297 V53D probably benign Het
Bglap T A 3: 88,383,655 I90F probably benign Het
C2cd4b G A 9: 67,760,691 R323H probably damaging Het
Cdh5 T A 8: 104,130,902 probably null Het
Cdh8 T A 8: 99,279,478 D159V probably damaging Het
Dnah7a A G 1: 53,456,612 Y3229H possibly damaging Het
Dzip1 T C 14: 118,902,139 E381G probably damaging Het
Elmod1 A G 9: 53,926,106 probably benign Het
Exosc10 T C 4: 148,581,113 S811P probably benign Het
Fhl3 A G 4: 124,705,677 Y15C probably benign Het
Hey2 C A 10: 30,833,957 A267S probably benign Het
Iqce A T 5: 140,686,107 probably null Het
Katnal2 A T 18: 77,002,560 probably null Het
Kdm2b G A 5: 122,961,134 probably benign Het
Mov10l1 A G 15: 88,998,766 probably null Het
Numa1 A G 7: 102,013,897 T724A probably benign Het
Oas3 A G 5: 120,771,149 F244S probably damaging Het
Olfr1472 T C 19: 13,453,705 I271V probably benign Het
Olfr715 G A 7: 107,129,343 L17F probably benign Het
Ppil2 A G 16: 17,107,219 S30P probably benign Het
Rab37 T G 11: 115,160,523 probably benign Het
Riox2 T C 16: 59,489,579 probably benign Het
Ryr3 A G 2: 112,678,481 S3358P probably damaging Het
Sash1 T A 10: 8,729,782 H948L probably benign Het
Serpinb6e T A 13: 33,841,074 N78I probably damaging Het
Slc25a47 G A 12: 108,854,258 V63M probably damaging Het
Slc9b1 A T 3: 135,394,074 probably benign Het
Strip2 T A 6: 29,931,210 S387T probably benign Het
Tcaf3 T C 6: 42,596,843 N145S probably benign Het
Tex10 C T 4: 48,456,800 R637Q probably benign Het
Trmu T C 15: 85,896,826 probably benign Het
Vezf1 A T 11: 88,068,435 probably benign Het
Vmn2r116 C T 17: 23,386,915 T267I probably damaging Het
Whrn C A 4: 63,415,567 A450S probably damaging Het
Other mutations in Gstz1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01019:Gstz1 APN 12 87163801 missense probably damaging 1.00
IGL02090:Gstz1 APN 12 87163754 missense probably benign
R0078:Gstz1 UTSW 12 87159703 missense probably benign 0.13
R3429:Gstz1 UTSW 12 87163696 splice site probably null
R4673:Gstz1 UTSW 12 87162063 missense probably benign 0.08
R4706:Gstz1 UTSW 12 87159120 missense probably benign 0.00
R6026:Gstz1 UTSW 12 87160174 missense probably damaging 0.99
R6938:Gstz1 UTSW 12 87147169 critical splice donor site probably null
X0019:Gstz1 UTSW 12 87159096 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CTGACACCAGAATTCAGAGCCGTC -3'
(R):5'- TGAATCTGCTGCTTCCTGAGGAAAG -3'

Sequencing Primer
(F):5'- GATGTTAGATGATAGCACTCCAGACC -3'
(R):5'- tgtcactcttcttgctgcc -3'
Posted On2013-07-11