Incidental Mutation 'R7201:Lyst'
ID560328
Institutional Source Beutler Lab
Gene Symbol Lyst
Ensembl Gene ENSMUSG00000019726
Gene Namelysosomal trafficking regulator
SynonymsD13Sfk13
MMRRC Submission
Accession Numbers

Ncbi RefSeq: NM_010748.2; MGI:107448

Is this an essential gene? Possibly non essential (E-score: 0.329) question?
Stock #R7201 (G1)
Quality Score225.009
Status Validated
Chromosome13
Chromosomal Location13590397-13778803 bp(+) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) T to A at 13709300 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Stop codon at position 2924 (Y2924*)
Ref Sequence ENSEMBL: ENSMUSP00000106188 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000110559]
Predicted Effect probably null
Transcript: ENSMUST00000110559
AA Change: Y2924*
SMART Domains Protein: ENSMUSP00000106188
Gene: ENSMUSG00000019726
AA Change: Y2924*

DomainStartEndE-ValueType
low complexity region 26 36 N/A INTRINSIC
low complexity region 72 82 N/A INTRINSIC
low complexity region 399 412 N/A INTRINSIC
low complexity region 1333 1344 N/A INTRINSIC
low complexity region 2295 2307 N/A INTRINSIC
low complexity region 2427 2445 N/A INTRINSIC
low complexity region 2534 2546 N/A INTRINSIC
Pfam:PH_BEACH 3006 3101 5.8e-25 PFAM
Beach 3118 3408 1.25e-193 SMART
Blast:Beach 3441 3478 9e-13 BLAST
WD40 3539 3579 5.75e-1 SMART
WD40 3591 3630 2.89e-5 SMART
WD40 3633 3676 1.38e0 SMART
WD40 3724 3765 1.27e-1 SMART
Meta Mutation Damage Score 0.9755 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.3%
Validation Efficiency 99% (80/81)
MGI Phenotype Strain: 1855968
FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein that regulates intracellular protein trafficking in endosomes, and may be involved in pigmentation. Mutations in this gene are associated with Chediak-Higashi syndrome, a lysosomal storage disorder. Alternative splicing results in multiple transcript variants, though the full-length nature of some of these variants has not been determined. [provided by RefSeq, Apr 2013]
PHENOTYPE: Homozygous mice have a phenotype similar to human Chediak-Higashi syndrome patients, exhibiting lysosomal dysfunction with resultant protein storage; diluted coat color; abnormal melanogenesis; immune cell dysfunction resulting in increased susceptibility to bacterial, viral, and parasitic infections and decreased cytotoxic activity against tumor cells. [provided by MGI curators]
Allele List at MGI

All alleles(52) : Targeted(3) Gene trapped(34) Spontaneous(8) Chemically induced(6) Radiation induced(1)

Other mutations in this stock
Total: 81 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4932415D10Rik T C 10: 82,291,627 M1850V probably benign Het
4933406M09Rik A G 1: 134,390,468 D326G possibly damaging Het
Acaca A G 11: 84,262,474 T903A probably benign Het
Acin1 A T 14: 54,664,899 S479T possibly damaging Het
Actr6 A T 10: 89,712,512 D370E probably benign Het
Adgrl3 T C 5: 81,724,222 F921S probably damaging Het
Ankmy1 A T 1: 92,886,824 H320Q possibly damaging Het
Arhgef5 C T 6: 43,273,232 Q306* probably null Het
Arntl T A 7: 113,285,142 M122K probably damaging Het
Art4 A T 6: 136,854,549 V198E probably benign Het
Asph G A 4: 9,474,917 R686W probably damaging Het
Atg7 A G 6: 114,777,057 H724R probably damaging Het
B020004J07Rik T A 4: 101,838,141 probably null Het
BC034090 A G 1: 155,241,934 V146A probably damaging Het
Bcl2a1d T A 9: 88,731,586 Q45L probably damaging Het
Ccdc36 A T 9: 108,404,775 D571E probably damaging Het
Cd28 G T 1: 60,763,173 E84* probably null Het
Ceacam3 G A 7: 17,158,238 W302* probably null Het
Cerkl T C 2: 79,333,590 N462S probably benign Het
Cisd2 A T 3: 135,411,213 L39H probably damaging Het
Col11a1 C A 3: 114,090,157 T225K unknown Het
Col15a1 A T 4: 47,307,752 Y1178F possibly damaging Het
Cul4a T C 8: 13,142,991 S630P probably damaging Het
Cyp2c38 T A 19: 39,401,776 I327F probably damaging Het
Cyp3a25 A C 5: 145,991,447 S263A probably benign Het
Cyp3a25 T A 5: 146,003,058 L46F probably benign Het
D17Wsu92e A C 17: 27,794,070 probably null Het
Dmrta1 T A 4: 89,692,171 L456* probably null Het
Dnah12 T C 14: 26,814,622 L2165P probably benign Het
Dsg1a C A 18: 20,328,311 S253R probably damaging Het
Egln2 A C 7: 27,160,319 I323S probably damaging Het
Fam171b A G 2: 83,878,230 T359A probably damaging Het
Fcgr2b G T 1: 170,963,397 Q276K probably benign Het
Fcrls C T 3: 87,252,627 C440Y probably damaging Het
Fmnl2 T C 2: 53,073,654 V266A unknown Het
Glo1 A T 17: 30,597,854 D109E probably benign Het
Grin3b A G 10: 79,974,078 R473G possibly damaging Het
Ica1 G A 6: 8,644,015 L425F probably damaging Het
Kcnq5 T C 1: 21,402,875 E716G possibly damaging Het
Klra17 A T 6: 129,873,343 I48K possibly damaging Het
Lrrc66 G T 5: 73,629,897 Q37K probably benign Het
Ly6a T A 15: 74,996,476 T55S probably benign Het
Lyzl6 A G 11: 103,631,351 Y140H probably benign Het
Mak T C 13: 41,051,440 I141V possibly damaging Het
Mapk7 A G 11: 61,489,172 I789T probably benign Het
Mrpl4 T C 9: 21,007,338 I123T probably benign Het
Mup18 G C 4: 61,673,336 probably null Het
Myef2 T C 2: 125,096,162 probably null Het
Myh7 T C 14: 54,990,945 T235A possibly damaging Het
Myo18b C T 5: 112,715,459 C2171Y probably damaging Het
Nat8 A T 6: 85,830,895 Y85* probably null Het
Nyap1 A T 5: 137,736,262 S170T probably damaging Het
Ogfr AGCCAGGTGGGGCCAGAGGACCCCAAAAGCCAGGTGGGGCCAGAGGACCCAAAAGGCCAGGTGGAGCCAGAGGACCCAAAAGGCCAGGTGGGGCCAGAAGACCCAAAAGGCCAGGTGGGGCCAGAGGACCCAAAAGGCCAGGTGGGGCCAGAGGACCCCAAAAGCCAGGTGGGGCCAGAGGACCCCAAAAGCCAGGTGGAGCCAGAGGACCCCAAAAGCCAGGTGGAGCCAGAGGACCCCAAAAGCCAGGTGGAGCCAGAGGACCCCAAAAGCCAGGTGGGGCCAGAGGACCCCCAAAGCCAGGTGGGGCCAGAG AGCCAGGTGGAGCCAGAGGACCCAAAAGGCCAGGTGGGGCCAGAAGACCCAAAAGGCCAGGTGGGGCCAGAGGACCCAAAAGGCCAGGTGGGGCCAGAGGACCCCAAAAGCCAGGTGGGGCCAGAGGACCCCAAAAGCCAGGTGGAGCCAGAGGACCCCAAAAGCCAGGTGGAGCCAGAGGACCCCAAAAGCCAGGTGGAGCCAGAGGACCCCAAAAGCCAGGTGGGGCCAGAGGACCCCCAAAGCCAGGTGGGGCCAGAG 2: 180,595,094 probably benign Het
Olfr392 A G 11: 73,814,341 V247A probably benign Het
Olfr559 T A 7: 102,724,485 I2F probably benign Het
Olfr718-ps1 A G 5: 143,137,798 Y157H probably damaging Het
Papss1 T C 3: 131,599,926 L244P probably damaging Het
Pibf1 A T 14: 99,196,408 D597V probably damaging Het
Pmpcb T A 5: 21,737,179 M1K probably null Het
Ppwd1 G A 13: 104,207,172 P575L probably damaging Het
Prc1 A G 7: 80,311,089 Q457R possibly damaging Het
Prdm10 T C 9: 31,316,306 V69A possibly damaging Het
Prkdc A G 16: 15,698,803 I1014V probably benign Het
Rab3gap2 A G 1: 185,267,191 Y999C probably damaging Het
Robo3 G A 9: 37,424,330 Q539* probably null Het
Rps12 A G 10: 23,785,231 Y127H probably benign Het
Sar1b A G 11: 51,788,252 D116G probably benign Het
Selenbp2 C T 3: 94,702,357 P294L probably benign Het
Slc6a2 T C 8: 92,995,672 Y516H probably damaging Het
Slit2 A G 5: 48,237,285 N673S probably null Het
Snap91 A T 9: 86,790,146 probably null Het
Srpk2 A G 5: 23,507,628 F653L possibly damaging Het
Supt5 A T 7: 28,316,788 S824T probably benign Het
Taar7a A G 10: 23,992,460 V341A probably benign Het
Tmem52 G A 4: 155,470,321 G134R probably damaging Het
Ush2a A G 1: 188,874,754 T3949A probably benign Het
Usp32 GAACAAGTCCACAACAA GAACAA 11: 85,022,855 probably null Het
Vmn1r173 A T 7: 23,702,158 probably benign Het
Vmn2r118 G A 17: 55,608,496 R485* probably null Het
Vwce A G 19: 10,638,115 E120G possibly damaging Het
Zfp143 T C 7: 110,093,080 V566A possibly damaging Het
Other mutations in Lyst
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00156:Lyst APN 13 13648878 missense probably benign
IGL00474:Lyst APN 13 13643536 missense possibly damaging 0.48
IGL00484:Lyst APN 13 13709603 missense probably benign 0.02
IGL00492:Lyst APN 13 13678175 missense possibly damaging 0.54
IGL00807:Lyst APN 13 13650423 missense possibly damaging 0.91
IGL00949:Lyst APN 13 13635485 missense possibly damaging 0.87
IGL00952:Lyst APN 13 13678107 missense probably benign 0.05
IGL01305:Lyst APN 13 13678056 missense probably benign 0.01
IGL01317:Lyst APN 13 13670870 missense probably benign
IGL01419:Lyst APN 13 13635838 missense probably benign 0.00
IGL01445:Lyst APN 13 13651714 missense probably benign 0.00
IGL01690:Lyst APN 13 13743246 missense probably damaging 1.00
IGL01791:Lyst APN 13 13635302 missense probably damaging 1.00
IGL01809:Lyst APN 13 13637803 missense probably damaging 1.00
IGL01896:Lyst APN 13 13635577 missense probably benign 0.04
IGL01938:Lyst APN 13 13637424 missense possibly damaging 0.93
IGL01986:Lyst APN 13 13775627 critical splice donor site probably null
IGL02022:Lyst APN 13 13664044 nonsense probably null
IGL02044:Lyst APN 13 13712846 missense probably damaging 1.00
IGL02157:Lyst APN 13 13660956 missense probably benign
IGL02185:Lyst APN 13 13661093 nonsense probably null
IGL02215:Lyst APN 13 13660956 missense probably benign
IGL02245:Lyst APN 13 13660956 missense probably benign
IGL02246:Lyst APN 13 13660956 missense probably benign
IGL02247:Lyst APN 13 13660956 missense probably benign
IGL02297:Lyst APN 13 13638092 nonsense probably null
IGL02411:Lyst APN 13 13660956 missense probably benign
IGL02415:Lyst APN 13 13660956 missense probably benign
IGL02419:Lyst APN 13 13660956 missense probably benign
IGL02420:Lyst APN 13 13660956 missense probably benign
IGL02429:Lyst APN 13 13660956 missense probably benign
IGL02501:Lyst APN 13 13711645 missense probably benign 0.02
IGL02522:Lyst APN 13 13634705 missense possibly damaging 0.81
IGL02535:Lyst APN 13 13650342 missense probably benign 0.00
IGL02596:Lyst APN 13 13660956 missense probably benign
IGL02601:Lyst APN 13 13660956 missense probably benign
IGL02603:Lyst APN 13 13660956 missense probably benign
IGL02608:Lyst APN 13 13712754 missense probably damaging 0.98
IGL02622:Lyst APN 13 13681390 missense probably damaging 1.00
IGL02690:Lyst APN 13 13641125 missense possibly damaging 0.58
IGL02715:Lyst APN 13 13674320 splice site probably null
IGL02725:Lyst APN 13 13760827 missense probably damaging 1.00
IGL02729:Lyst APN 13 13674339 missense possibly damaging 0.81
IGL02729:Lyst APN 13 13746609 missense possibly damaging 0.95
IGL02820:Lyst APN 13 13638058 missense probably benign 0.03
IGL02945:Lyst APN 13 13761198 missense possibly damaging 0.48
IGL02981:Lyst APN 13 13634911 missense probably damaging 0.99
IGL03087:Lyst APN 13 13635056 missense probably damaging 1.00
IGL03149:Lyst APN 13 13681444 missense probably benign 0.14
IGL03158:Lyst APN 13 13651752 critical splice donor site probably null
IGL03226:Lyst APN 13 13709559 missense probably benign 0.01
IGL03242:Lyst APN 13 13656881 nonsense probably null
IGL03385:Lyst APN 13 13656980 nonsense probably null
50-cal UTSW 13 13708212 critical splice donor site probably null
charcoal UTSW 13 13696761 nonsense probably null
charlotte_gray UTSW 13 13602026 intron probably benign
charzard UTSW 13 13647083 nonsense probably null
grey_wolf UTSW 13 unclassified
lightspeed UTSW 13 13740536 missense possibly damaging 0.91
robin UTSW 13 13648802 nonsense probably null
sooty UTSW 13 unclassified
souris UTSW 13 13683224 unclassified probably benign
Swallow UTSW 13 13757422 missense probably benign 0.00
vulpix UTSW 13 13696794 splice site probably null
ANU22:Lyst UTSW 13 13678056 missense probably benign 0.01
IGL02835:Lyst UTSW 13 13661100 missense possibly damaging 0.82
P0031:Lyst UTSW 13 13664031 missense probably damaging 1.00
R0012:Lyst UTSW 13 13687694 missense probably benign 0.10
R0012:Lyst UTSW 13 13687694 missense probably benign 0.10
R0031:Lyst UTSW 13 13708156 missense probably benign 0.14
R0115:Lyst UTSW 13 13677952 missense probably benign 0.00
R0212:Lyst UTSW 13 13635985 missense possibly damaging 0.93
R0386:Lyst UTSW 13 13708214 splice site probably benign
R0393:Lyst UTSW 13 13647079 missense probably benign 0.01
R0415:Lyst UTSW 13 13711610 splice site probably benign
R0446:Lyst UTSW 13 13638048 missense probably benign 0.00
R0481:Lyst UTSW 13 13677952 missense probably benign 0.00
R0499:Lyst UTSW 13 13616713 missense probably damaging 1.00
R0506:Lyst UTSW 13 13638015 missense probably benign
R0530:Lyst UTSW 13 13757306 splice site probably benign
R0541:Lyst UTSW 13 13681293 missense probably benign 0.00
R0570:Lyst UTSW 13 13709386 missense probably benign 0.26
R0680:Lyst UTSW 13 13650341 missense probably benign 0.01
R0842:Lyst UTSW 13 13678241 nonsense probably null
R0848:Lyst UTSW 13 13634930 missense probably benign 0.00
R1014:Lyst UTSW 13 13634060 missense possibly damaging 0.49
R1205:Lyst UTSW 13 13680202 missense probably benign
R1251:Lyst UTSW 13 13634483 missense probably benign 0.00
R1304:Lyst UTSW 13 13751984 nonsense probably null
R1398:Lyst UTSW 13 13740536 missense possibly damaging 0.91
R1445:Lyst UTSW 13 13640054 missense possibly damaging 0.94
R1475:Lyst UTSW 13 13708212 critical splice donor site probably null
R1479:Lyst UTSW 13 13634482 missense probably benign 0.00
R1484:Lyst UTSW 13 13678190 missense probably benign 0.01
R1498:Lyst UTSW 13 13650375 missense possibly damaging 0.49
R1540:Lyst UTSW 13 13635101 missense possibly damaging 0.81
R1611:Lyst UTSW 13 13634897 missense probably damaging 0.97
R1653:Lyst UTSW 13 13635226 missense probably damaging 1.00
R1669:Lyst UTSW 13 13644087 missense possibly damaging 0.90
R1686:Lyst UTSW 13 13634705 missense possibly damaging 0.81
R1694:Lyst UTSW 13 13661161 missense probably damaging 0.98
R1747:Lyst UTSW 13 13757422 missense probably benign 0.00
R1793:Lyst UTSW 13 13647083 nonsense probably null
R1871:Lyst UTSW 13 13651712 missense probably benign 0.00
R1905:Lyst UTSW 13 13634134 missense probably benign
R1958:Lyst UTSW 13 13616618 missense probably damaging 1.00
R1969:Lyst UTSW 13 13730344 missense probably damaging 0.99
R2040:Lyst UTSW 13 13641222 missense probably benign 0.00
R2109:Lyst UTSW 13 13712820 missense possibly damaging 0.46
R2116:Lyst UTSW 13 13635701 missense probably damaging 0.99
R2121:Lyst UTSW 13 13660971 missense probably damaging 1.00
R2127:Lyst UTSW 13 13635262 missense probably damaging 1.00
R2187:Lyst UTSW 13 13709341 missense possibly damaging 0.61
R2238:Lyst UTSW 13 13743263 missense probably benign 0.41
R2258:Lyst UTSW 13 13637658 missense probably benign 0.00
R2292:Lyst UTSW 13 13740495 missense probably damaging 1.00
R2368:Lyst UTSW 13 13696663 missense probably damaging 0.96
R2908:Lyst UTSW 13 13669873 missense probably benign 0.03
R3001:Lyst UTSW 13 13696705 missense probably benign
R3002:Lyst UTSW 13 13696705 missense probably benign
R3024:Lyst UTSW 13 13658687 missense probably benign
R3113:Lyst UTSW 13 13669927 missense probably benign 0.12
R3406:Lyst UTSW 13 13635230 missense possibly damaging 0.56
R3972:Lyst UTSW 13 13706625 missense possibly damaging 0.67
R3978:Lyst UTSW 13 13634168 missense possibly damaging 0.82
R4032:Lyst UTSW 13 13616665 missense probably damaging 1.00
R4192:Lyst UTSW 13 13740513 missense probably damaging 1.00
R4206:Lyst UTSW 13 13635989 missense probably benign 0.03
R4298:Lyst UTSW 13 13634887 missense probably damaging 1.00
R4344:Lyst UTSW 13 13698466 missense probably benign 0.06
R4441:Lyst UTSW 13 13635383 missense probably damaging 1.00
R4445:Lyst UTSW 13 13709564 missense probably benign 0.42
R4477:Lyst UTSW 13 13635383 missense probably damaging 1.00
R4493:Lyst UTSW 13 13635383 missense probably damaging 1.00
R4494:Lyst UTSW 13 13635383 missense probably damaging 1.00
R4495:Lyst UTSW 13 13635383 missense probably damaging 1.00
R4622:Lyst UTSW 13 13674398 missense probably benign 0.01
R4638:Lyst UTSW 13 13696794 splice site probably null
R4658:Lyst UTSW 13 13635383 missense probably damaging 1.00
R4675:Lyst UTSW 13 13635383 missense probably damaging 1.00
R4719:Lyst UTSW 13 13650350 missense probably benign
R4729:Lyst UTSW 13 13637901 missense probably damaging 1.00
R4774:Lyst UTSW 13 13740597 missense probably damaging 1.00
R4811:Lyst UTSW 13 13777100 missense probably benign 0.33
R4877:Lyst UTSW 13 13683149 missense probably damaging 1.00
R4920:Lyst UTSW 13 13647060 missense possibly damaging 0.79
R4933:Lyst UTSW 13 13637764 missense probably damaging 0.98
R4933:Lyst UTSW 13 13759378 missense probably benign 0.12
R4958:Lyst UTSW 13 13635463 missense probably benign 0.00
R4982:Lyst UTSW 13 13725954 missense probably damaging 1.00
R4992:Lyst UTSW 13 13661163 missense probably damaging 1.00
R5024:Lyst UTSW 13 13634404 missense probably benign
R5049:Lyst UTSW 13 13636064 missense probably damaging 1.00
R5079:Lyst UTSW 13 13757353 missense probably benign 0.08
R5254:Lyst UTSW 13 13683070 missense probably benign 0.00
R5266:Lyst UTSW 13 13660970 missense probably damaging 1.00
R5279:Lyst UTSW 13 13648802 nonsense probably null
R5285:Lyst UTSW 13 13634426 missense probably benign 0.01
R5364:Lyst UTSW 13 13656854 missense probably benign 0.35
R5435:Lyst UTSW 13 13777064 missense possibly damaging 0.64
R5516:Lyst UTSW 13 13644122 missense probably benign 0.10
R5524:Lyst UTSW 13 13746779 missense probably benign 0.03
R5591:Lyst UTSW 13 13743333 missense probably damaging 0.99
R5592:Lyst UTSW 13 13743333 missense probably damaging 0.99
R5593:Lyst UTSW 13 13743333 missense probably damaging 0.99
R5594:Lyst UTSW 13 13743333 missense probably damaging 0.99
R5594:Lyst UTSW 13 13759397 missense probably benign 0.00
R5644:Lyst UTSW 13 13637496 missense possibly damaging 0.58
R5659:Lyst UTSW 13 13634627 missense possibly damaging 0.58
R5741:Lyst UTSW 13 13634030 missense probably benign 0.44
R5908:Lyst UTSW 13 13696761 nonsense probably null
R5969:Lyst UTSW 13 13687813 splice site probably null
R6128:Lyst UTSW 13 13759379 missense possibly damaging 0.67
R6271:Lyst UTSW 13 13658754 missense probably benign 0.30
R6315:Lyst UTSW 13 13643504 missense probably benign
R6318:Lyst UTSW 13 13743311 missense possibly damaging 0.88
R6555:Lyst UTSW 13 13648925 missense probably benign 0.01
R6663:Lyst UTSW 13 13664116 splice site probably null
R6701:Lyst UTSW 13 13681485 missense probably benign 0.06
R6711:Lyst UTSW 13 13635235 missense possibly damaging 0.80
R6909:Lyst UTSW 13 13743375 missense probably damaging 1.00
R6915:Lyst UTSW 13 13726044 missense probably benign 0.01
R6929:Lyst UTSW 13 13743324 missense probably damaging 1.00
R6960:Lyst UTSW 13 13634078 missense probably benign 0.12
R7018:Lyst UTSW 13 13743459 critical splice donor site probably null
R7037:Lyst UTSW 13 13616666 missense probably damaging 1.00
R7045:Lyst UTSW 13 13634900 missense probably benign 0.34
R7045:Lyst UTSW 13 13637708 missense probably damaging 1.00
R7070:Lyst UTSW 13 13757444 missense probably benign 0.23
R7188:Lyst UTSW 13 13752090 missense possibly damaging 0.66
R7210:Lyst UTSW 13 13656983 missense probably damaging 1.00
R7229:Lyst UTSW 13 13643509 missense probably benign 0.00
R7293:Lyst UTSW 13 13680237 missense probably benign 0.01
R7318:Lyst UTSW 13 13757443 missense probably benign 0.13
R7344:Lyst UTSW 13 13706555 missense probably benign
R7426:Lyst UTSW 13 13637524 missense probably benign
R7522:Lyst UTSW 13 13647083 nonsense probably null
R7583:Lyst UTSW 13 13635887 missense probably damaging 1.00
R7606:Lyst UTSW 13 13637475 missense probably damaging 1.00
R7636:Lyst UTSW 13 13616747 critical splice donor site probably null
R7658:Lyst UTSW 13 13730476 missense possibly damaging 0.63
R7685:Lyst UTSW 13 13669865 missense probably benign 0.00
R7689:Lyst UTSW 13 13683223 critical splice donor site probably null
R7765:Lyst UTSW 13 13709532 missense possibly damaging 0.75
R7779:Lyst UTSW 13 13634543 missense probably damaging 1.00
R7871:Lyst UTSW 13 13636052 nonsense probably null
R7872:Lyst UTSW 13 13635865 missense probably benign 0.14
R7884:Lyst UTSW 13 13707683 missense probably benign 0.09
R7890:Lyst UTSW 13 13740569 missense probably damaging 0.99
R7948:Lyst UTSW 13 13746589 missense possibly damaging 0.59
R8048:Lyst UTSW 13 13687645 missense probably benign 0.12
R8085:Lyst UTSW 13 13634309 missense probably damaging 0.98
R8165:Lyst UTSW 13 13698360 missense probably damaging 0.99
R8235:Lyst UTSW 13 13760738 missense possibly damaging 0.69
R8237:Lyst UTSW 13 13651732 missense probably benign 0.00
R8275:Lyst UTSW 13 13776082 missense probably benign 0.02
R8300:Lyst UTSW 13 13664058 missense possibly damaging 0.79
RF001:Lyst UTSW 13 13635841 missense probably benign
RF002:Lyst UTSW 13 13634363 missense probably benign 0.05
X0024:Lyst UTSW 13 13634448 missense probably benign 0.00
X0026:Lyst UTSW 13 13751970 missense probably damaging 0.99
Z1088:Lyst UTSW 13 13743433 missense probably benign 0.09
Z1176:Lyst UTSW 13 13640107 missense probably damaging 1.00
Z1176:Lyst UTSW 13 13777079 missense probably benign 0.27
Z1177:Lyst UTSW 13 13680134 missense possibly damaging 0.73
Predicted Primers PCR Primer
(F):5'- GGACACTCACTTTCTTTGTCAG -3'
(R):5'- GCACACCTGTGGAGAAAACG -3'

Sequencing Primer
(F):5'- CTGATGTACAGACCGTTGT -3'
(R):5'- CGTACACAGCGTTTATCTAGCAACTG -3'
Posted On2019-06-26