Incidental Mutation 'R0592:Slc25a47'
ID56033
Institutional Source Beutler Lab
Gene Symbol Slc25a47
Ensembl Gene ENSMUSG00000048856
Gene Namesolute carrier family 25, member 47
Synonyms
MMRRC Submission 038782-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R0592 (G1)
Quality Score171
Status Validated
Chromosome12
Chromosomal Location108836046-108856815 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 108854258 bp
ZygosityHeterozygous
Amino Acid Change Valine to Methionine at position 63 (V63M)
Ref Sequence ENSEMBL: ENSMUSP00000152260 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000057026] [ENSMUST00000221080]
Predicted Effect possibly damaging
Transcript: ENSMUST00000057026
AA Change: V63M

PolyPhen 2 Score 0.948 (Sensitivity: 0.79; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000050329
Gene: ENSMUSG00000048856
AA Change: V63M

DomainStartEndE-ValueType
Pfam:Mito_carr 1 84 1.2e-19 PFAM
Pfam:Mito_carr 94 212 1.5e-19 PFAM
Pfam:Mito_carr 215 308 6.1e-24 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000221080
AA Change: V63M

PolyPhen 2 Score 0.982 (Sensitivity: 0.75; Specificity: 0.96)
Predicted Effect noncoding transcript
Transcript: ENSMUST00000221787
Predicted Effect noncoding transcript
Transcript: ENSMUST00000223296
Meta Mutation Damage Score 0.2150 question?
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.9%
  • 10x: 97.5%
  • 20x: 95.0%
Validation Efficiency 100% (35/35)
Allele List at MGI
Other mutations in this stock
Total: 35 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Atg2a GCCTTCCTTCCTTCCTTCCTTCCTTCCTTCCTTCC GCCTTCCTTCCTTCCTTCCTTCCTTCCTTCCTTCCTTCC 19: 6,245,007 probably benign Het
Bbs7 A T 3: 36,610,297 V53D probably benign Het
Bglap T A 3: 88,383,655 I90F probably benign Het
C2cd4b G A 9: 67,760,691 R323H probably damaging Het
Cdh5 T A 8: 104,130,902 probably null Het
Cdh8 T A 8: 99,279,478 D159V probably damaging Het
Dnah7a A G 1: 53,456,612 Y3229H possibly damaging Het
Dzip1 T C 14: 118,902,139 E381G probably damaging Het
Elmod1 A G 9: 53,926,106 probably benign Het
Exosc10 T C 4: 148,581,113 S811P probably benign Het
Fhl3 A G 4: 124,705,677 Y15C probably benign Het
Gstz1 G A 12: 87,163,721 S126N probably benign Het
Hey2 C A 10: 30,833,957 A267S probably benign Het
Iqce A T 5: 140,686,107 probably null Het
Katnal2 A T 18: 77,002,560 probably null Het
Kdm2b G A 5: 122,961,134 probably benign Het
Mov10l1 A G 15: 88,998,766 probably null Het
Numa1 A G 7: 102,013,897 T724A probably benign Het
Oas3 A G 5: 120,771,149 F244S probably damaging Het
Olfr1472 T C 19: 13,453,705 I271V probably benign Het
Olfr715 G A 7: 107,129,343 L17F probably benign Het
Ppil2 A G 16: 17,107,219 S30P probably benign Het
Rab37 T G 11: 115,160,523 probably benign Het
Riox2 T C 16: 59,489,579 probably benign Het
Ryr3 A G 2: 112,678,481 S3358P probably damaging Het
Sash1 T A 10: 8,729,782 H948L probably benign Het
Serpinb6e T A 13: 33,841,074 N78I probably damaging Het
Slc9b1 A T 3: 135,394,074 probably benign Het
Strip2 T A 6: 29,931,210 S387T probably benign Het
Tcaf3 T C 6: 42,596,843 N145S probably benign Het
Tex10 C T 4: 48,456,800 R637Q probably benign Het
Trmu T C 15: 85,896,826 probably benign Het
Vezf1 A T 11: 88,068,435 probably benign Het
Vmn2r116 C T 17: 23,386,915 T267I probably damaging Het
Whrn C A 4: 63,415,567 A450S probably damaging Het
Other mutations in Slc25a47
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00905:Slc25a47 APN 12 108855388 missense probably benign 0.00
IGL01138:Slc25a47 APN 12 108856022 missense probably damaging 1.00
IGL01545:Slc25a47 APN 12 108854216 missense probably benign 0.06
IGL01978:Slc25a47 APN 12 108851190 missense probably damaging 0.96
R4783:Slc25a47 UTSW 12 108855334 missense probably damaging 1.00
R5549:Slc25a47 UTSW 12 108856217 makesense probably null
R6085:Slc25a47 UTSW 12 108854328 missense probably benign 0.19
R6378:Slc25a47 UTSW 12 108856143 missense probably damaging 1.00
R6612:Slc25a47 UTSW 12 108855978 missense probably benign 0.02
R7237:Slc25a47 UTSW 12 108855460 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GCCTTAGCCTGTGGACACAGTAAC -3'
(R):5'- TGATGATCCAGACTCTCTGGGAGC -3'

Sequencing Primer
(F):5'- AGCTGAATATCACGCTGGCTC -3'
(R):5'- ACTCTCTGGGAGCCTCCAAC -3'
Posted On2013-07-11