Incidental Mutation 'R0592:Serpinb6e'
ID56034
Institutional Source Beutler Lab
Gene Symbol Serpinb6e
Ensembl Gene ENSMUSG00000069248
Gene Nameserine (or cysteine) peptidase inhibitor, clade B, member 6e
Synonymsovalbumin, SPI3B, Gm11396
MMRRC Submission 038782-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.088) question?
Stock #R0592 (G1)
Quality Score205
Status Validated
Chromosome13
Chromosomal Location33832345-33843408 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 33841074 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Isoleucine at position 78 (N78I)
Ref Sequence ENSEMBL: ENSMUSP00000105904 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000110275] [ENSMUST00000145221]
Predicted Effect probably damaging
Transcript: ENSMUST00000110275
AA Change: N78I

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000105904
Gene: ENSMUSG00000069248
AA Change: N78I

DomainStartEndE-ValueType
SERPIN 65 429 4.43e-149 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000145221
AA Change: N78I

PolyPhen 2 Score 0.994 (Sensitivity: 0.69; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000117577
Gene: ENSMUSG00000069248
AA Change: N78I

DomainStartEndE-ValueType
Pfam:Serpin 58 101 1.9e-9 PFAM
Meta Mutation Damage Score 0.9742 question?
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.9%
  • 10x: 97.5%
  • 20x: 95.0%
Validation Efficiency 100% (35/35)
Allele List at MGI
Other mutations in this stock
Total: 35 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Atg2a GCCTTCCTTCCTTCCTTCCTTCCTTCCTTCCTTCC GCCTTCCTTCCTTCCTTCCTTCCTTCCTTCCTTCCTTCC 19: 6,245,007 probably benign Het
Bbs7 A T 3: 36,610,297 V53D probably benign Het
Bglap T A 3: 88,383,655 I90F probably benign Het
C2cd4b G A 9: 67,760,691 R323H probably damaging Het
Cdh5 T A 8: 104,130,902 probably null Het
Cdh8 T A 8: 99,279,478 D159V probably damaging Het
Dnah7a A G 1: 53,456,612 Y3229H possibly damaging Het
Dzip1 T C 14: 118,902,139 E381G probably damaging Het
Elmod1 A G 9: 53,926,106 probably benign Het
Exosc10 T C 4: 148,581,113 S811P probably benign Het
Fhl3 A G 4: 124,705,677 Y15C probably benign Het
Gstz1 G A 12: 87,163,721 S126N probably benign Het
Hey2 C A 10: 30,833,957 A267S probably benign Het
Iqce A T 5: 140,686,107 probably null Het
Katnal2 A T 18: 77,002,560 probably null Het
Kdm2b G A 5: 122,961,134 probably benign Het
Mov10l1 A G 15: 88,998,766 probably null Het
Numa1 A G 7: 102,013,897 T724A probably benign Het
Oas3 A G 5: 120,771,149 F244S probably damaging Het
Olfr1472 T C 19: 13,453,705 I271V probably benign Het
Olfr715 G A 7: 107,129,343 L17F probably benign Het
Ppil2 A G 16: 17,107,219 S30P probably benign Het
Rab37 T G 11: 115,160,523 probably benign Het
Riox2 T C 16: 59,489,579 probably benign Het
Ryr3 A G 2: 112,678,481 S3358P probably damaging Het
Sash1 T A 10: 8,729,782 H948L probably benign Het
Slc25a47 G A 12: 108,854,258 V63M probably damaging Het
Slc9b1 A T 3: 135,394,074 probably benign Het
Strip2 T A 6: 29,931,210 S387T probably benign Het
Tcaf3 T C 6: 42,596,843 N145S probably benign Het
Tex10 C T 4: 48,456,800 R637Q probably benign Het
Trmu T C 15: 85,896,826 probably benign Het
Vezf1 A T 11: 88,068,435 probably benign Het
Vmn2r116 C T 17: 23,386,915 T267I probably damaging Het
Whrn C A 4: 63,415,567 A450S probably damaging Het
Other mutations in Serpinb6e
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02501:Serpinb6e APN 13 33832802 missense possibly damaging 0.46
IGL03174:Serpinb6e APN 13 33836480 missense probably damaging 0.99
R0018:Serpinb6e UTSW 13 33837845 missense probably damaging 1.00
R0145:Serpinb6e UTSW 13 33841060 missense probably benign 0.30
R0733:Serpinb6e UTSW 13 33841218 missense probably benign
R1347:Serpinb6e UTSW 13 33841197 missense possibly damaging 0.96
R1347:Serpinb6e UTSW 13 33841197 missense possibly damaging 0.96
R1651:Serpinb6e UTSW 13 33836423 missense probably benign 0.00
R1822:Serpinb6e UTSW 13 33833234 missense probably damaging 0.96
R2031:Serpinb6e UTSW 13 33837750 unclassified probably benign
R3740:Serpinb6e UTSW 13 33838960 missense probably benign 0.09
R4549:Serpinb6e UTSW 13 33833231 missense possibly damaging 0.92
R4658:Serpinb6e UTSW 13 33841316 start gained probably benign
R5149:Serpinb6e UTSW 13 33832485 missense probably damaging 0.99
R5736:Serpinb6e UTSW 13 33832770 missense probably damaging 0.96
R6060:Serpinb6e UTSW 13 33841273 missense possibly damaging 0.96
R6212:Serpinb6e UTSW 13 33841237 missense probably damaging 0.99
R6335:Serpinb6e UTSW 13 33837822 missense probably benign 0.44
R6818:Serpinb6e UTSW 13 33832354 utr 3 prime probably null
R7089:Serpinb6e UTSW 13 33832715 missense probably damaging 0.99
R7151:Serpinb6e UTSW 13 33837835 missense probably damaging 1.00
R7263:Serpinb6e UTSW 13 33838940 missense probably benign 0.03
R7528:Serpinb6e UTSW 13 33832491 missense possibly damaging 0.57
Z1177:Serpinb6e UTSW 13 33841238 missense not run
Predicted Primers PCR Primer
(F):5'- GCTAGGATTCCAACAAGGACAGCAC -3'
(R):5'- CAAGCAGTCAGACTTCGTACTTCCC -3'

Sequencing Primer
(F):5'- TCCCTATGTCAACTGCAAGAG -3'
(R):5'- gcctggacttgctatatcgac -3'
Posted On2013-07-11