Incidental Mutation 'R7202:Kdm5b'
ID 560344
Institutional Source Beutler Lab
Gene Symbol Kdm5b
Ensembl Gene ENSMUSG00000042207
Gene Name lysine demethylase 5B
Synonyms 2010009J12Rik, PLU-1, Rb-Bp2, Jarid1b, D1Ertd202e, Plu1, 2210016I17Rik
MMRRC Submission 045280-MU
Accession Numbers
Essential gene? Possibly non essential (E-score: 0.451) question?
Stock # R7202 (G1)
Quality Score 225.009
Status Validated
Chromosome 1
Chromosomal Location 134487916-134560621 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to G at 134552497 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Serine to Alanine at position 1158 (S1158A)
Ref Sequence ENSEMBL: ENSMUSP00000038138 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000047714] [ENSMUST00000112198]
AlphaFold Q80Y84
Predicted Effect probably benign
Transcript: ENSMUST00000047714
AA Change: S1158A

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000038138
Gene: ENSMUSG00000042207
AA Change: S1158A

DomainStartEndE-ValueType
low complexity region 7 30 N/A INTRINSIC
JmjN 31 72 2.87e-20 SMART
ARID 94 183 7.39e-32 SMART
BRIGHT 98 188 1.51e-35 SMART
low complexity region 228 239 N/A INTRINSIC
PHD 311 357 6.15e-14 SMART
JmjC 453 619 2.33e-67 SMART
Pfam:zf-C5HC2 692 744 2.2e-17 PFAM
Pfam:PLU-1 757 1088 5.6e-92 PFAM
low complexity region 1097 1109 N/A INTRINSIC
PHD 1178 1222 6.2e-10 SMART
low complexity region 1225 1236 N/A INTRINSIC
low complexity region 1406 1417 N/A INTRINSIC
low complexity region 1470 1484 N/A INTRINSIC
PHD 1486 1536 1.18e-6 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000112198
AA Change: S1158A

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000107817
Gene: ENSMUSG00000042207
AA Change: S1158A

DomainStartEndE-ValueType
low complexity region 7 30 N/A INTRINSIC
JmjN 31 72 2.87e-20 SMART
ARID 94 183 7.39e-32 SMART
BRIGHT 98 188 1.51e-35 SMART
low complexity region 228 239 N/A INTRINSIC
PHD 311 357 6.15e-14 SMART
JmjC 453 619 2.33e-67 SMART
Pfam:zf-C5HC2 692 745 6.7e-21 PFAM
Pfam:PLU-1 756 1088 6e-94 PFAM
low complexity region 1097 1109 N/A INTRINSIC
PHD 1178 1222 6.2e-10 SMART
low complexity region 1225 1236 N/A INTRINSIC
low complexity region 1406 1417 N/A INTRINSIC
low complexity region 1470 1484 N/A INTRINSIC
Meta Mutation Damage Score 0.0575 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency 99% (74/75)
MGI Phenotype FUNCTION: This gene encodes a lysine-specific histone demethylase that belongs to the jumonji/ARID domain-containing family of histone demethylases. The encoded protein is capable of demethylating tri-, di- and monomethylated lysine 4 of histone H3. This protein plays a role in the transcriptional repression or certain tumor suppressor genes and is upregulated in certain cancer cells. This protein may also play a role in genome stability and DNA repair. Homozygous mutant mice display decreased body weight, decreased female fertility, lower uterine weight, and a delay in mammary development. Knockout of this gene has also been associated with embryonic lethality. [provided by RefSeq, Dec 2016]
PHENOTYPE: Mice homozygous for a gene trapped allele exhibit decreased body weight, background-sensitive premature mortality, decreased female fertility, delayed mammary gland development, decreased serum estradiol levels, and reduced mammary epithelial cell proliferation in early puberty. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 74 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca14 T C 7: 119,917,236 (GRCm39) I1467T probably damaging Het
Abtb3 A G 10: 85,223,629 (GRCm39) E146G unknown Het
Adgrf3 T A 5: 30,409,378 (GRCm39) K38* probably null Het
Ahdc1 T A 4: 132,789,198 (GRCm39) C146* probably null Het
Ahnak A T 19: 8,995,163 (GRCm39) K5482N probably damaging Het
Arhgap23 C T 11: 97,342,819 (GRCm39) A367V possibly damaging Het
Arvcf T C 16: 18,223,948 (GRCm39) S960P probably damaging Het
Asb14 C A 14: 26,622,394 (GRCm39) P74Q probably benign Het
Atad5 T C 11: 79,980,601 (GRCm39) V2A probably damaging Het
Baz2a A G 10: 127,954,428 (GRCm39) I691M possibly damaging Het
Brca2 A G 5: 150,455,819 (GRCm39) T187A probably benign Het
Calr4 T A 4: 109,101,254 (GRCm39) N152K possibly damaging Het
Ccnb2 C T 9: 70,318,128 (GRCm39) A215T probably damaging Het
Cdh16 C T 8: 105,340,780 (GRCm39) D140N unknown Het
Ces1g T C 8: 94,029,595 (GRCm39) T546A probably benign Het
Cfap74 G T 4: 155,510,654 (GRCm39) probably null Het
Cfap91 T C 16: 38,155,959 (GRCm39) Y88C probably benign Het
Col5a1 G T 2: 27,842,390 (GRCm39) D422Y unknown Het
Cyp2c66 A T 19: 39,130,348 (GRCm39) Y61F probably damaging Het
Dnah12 G A 14: 26,500,869 (GRCm39) probably null Het
Dnah6 A G 6: 73,158,688 (GRCm39) probably null Het
Dop1a T G 9: 86,386,220 (GRCm39) probably null Het
Fam163a A G 1: 155,954,834 (GRCm39) F106L probably damaging Het
Gfy T C 7: 44,827,596 (GRCm39) T167A probably benign Het
Gm6525 A T 3: 84,082,341 (GRCm39) R87S probably benign Het
Gramd1c C A 16: 43,879,584 (GRCm39) A19S possibly damaging Het
Herc2 T C 7: 55,781,034 (GRCm39) V1233A probably damaging Het
Hibch G A 1: 52,892,874 (GRCm39) probably null Het
Ibsp A T 5: 104,450,027 (GRCm39) S9C probably benign Het
Il17ra A G 6: 120,452,572 (GRCm39) I252V probably benign Het
Ino80 A T 2: 119,204,918 (GRCm39) M1536K probably benign Het
Ipo11 A T 13: 107,012,078 (GRCm39) L568Q probably damaging Het
Kcnu1 T G 8: 26,409,609 (GRCm39) probably null Het
Kmt2a T C 9: 44,759,012 (GRCm39) T946A probably benign Het
Kmt2e A T 5: 23,697,292 (GRCm39) probably benign Het
Krba1 G A 6: 48,389,261 (GRCm39) V594M probably damaging Het
Lamb1 T C 12: 31,374,314 (GRCm39) L1559P probably damaging Het
Lig1 C T 7: 13,025,175 (GRCm39) P227S probably benign Het
Lims2 T A 18: 32,090,017 (GRCm39) D255E probably benign Het
Marchf3 C T 18: 56,909,161 (GRCm39) C208Y probably benign Het
Mei1 A G 15: 81,976,843 (GRCm39) E142G Het
Melk G T 4: 44,351,106 (GRCm39) R549L probably benign Het
Muc6 AGGCGCAGAAACCCTGGC AGGC 7: 141,214,363 (GRCm39) probably null Het
Myorg T C 4: 41,498,268 (GRCm39) Y454C probably damaging Het
Nae1 T C 8: 105,250,215 (GRCm39) Y226C possibly damaging Het
Nap1l1 T C 10: 111,326,964 (GRCm39) F175S probably damaging Het
Ndn T C 7: 61,998,709 (GRCm39) L185P probably damaging Het
Ndst3 T A 3: 123,465,388 (GRCm39) I195F possibly damaging Het
Ndufaf1 A T 2: 119,488,907 (GRCm39) S206T probably benign Het
Nek10 C A 14: 14,836,171 (GRCm38) H131N probably benign Het
Obsl1 T A 1: 75,466,360 (GRCm39) D1456V possibly damaging Het
Or10a2 A G 7: 106,673,448 (GRCm39) N138D probably benign Het
Or10ak7 C T 4: 118,791,215 (GRCm39) V277I probably benign Het
Or52s6 T A 7: 103,092,292 (GRCm39) T13S probably benign Het
Otog C T 7: 45,937,474 (GRCm39) L1728F probably damaging Het
Pcx A T 19: 4,652,361 (GRCm39) M150L possibly damaging Het
Pole A G 5: 110,444,973 (GRCm39) D443G possibly damaging Het
Prr14 G T 7: 127,075,648 (GRCm39) R552L probably damaging Het
Rasgrf1 T G 9: 89,899,125 (GRCm39) S1156A possibly damaging Het
Rfc4 T A 16: 22,946,359 (GRCm39) probably benign Het
Rfx5 G T 3: 94,866,272 (GRCm39) A524S unknown Het
Ryr3 G A 2: 112,596,664 (GRCm39) P2497S probably damaging Het
Scg3 T C 9: 75,590,992 (GRCm39) T6A probably benign Het
Slc26a9 A T 1: 131,690,526 (GRCm39) D510V possibly damaging Het
Stpg3 A G 2: 25,104,586 (GRCm39) F10L probably damaging Het
Tmc5 T A 7: 118,239,179 (GRCm39) H357Q possibly damaging Het
Tmem40 A T 6: 115,707,420 (GRCm39) L253H probably damaging Het
Tmie A G 9: 110,696,632 (GRCm39) V83A probably damaging Het
Uck2 A T 1: 167,054,084 (GRCm39) I218N probably damaging Het
Vtn A G 11: 78,391,626 (GRCm39) D310G possibly damaging Het
Wdr49 A T 3: 75,240,580 (GRCm39) S430T probably benign Het
Wtip A G 7: 33,832,087 (GRCm39) V133A probably benign Het
Zbtb9 T A 17: 27,193,666 (GRCm39) V357E probably damaging Het
Zfp953 G A 13: 67,491,706 (GRCm39) T82M probably benign Het
Other mutations in Kdm5b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00230:Kdm5b APN 1 134,548,693 (GRCm39) missense probably damaging 1.00
IGL01458:Kdm5b APN 1 134,549,724 (GRCm39) missense possibly damaging 0.53
IGL01567:Kdm5b APN 1 134,530,278 (GRCm39) missense probably damaging 1.00
IGL01625:Kdm5b APN 1 134,545,706 (GRCm39) missense possibly damaging 0.74
IGL01970:Kdm5b APN 1 134,528,465 (GRCm39) missense probably damaging 1.00
IGL02183:Kdm5b APN 1 134,552,669 (GRCm39) missense probably benign 0.09
IGL02592:Kdm5b APN 1 134,552,591 (GRCm39) missense probably damaging 0.99
IGL02695:Kdm5b APN 1 134,532,223 (GRCm39) missense possibly damaging 0.94
IGL02697:Kdm5b APN 1 134,516,511 (GRCm39) splice site probably benign
IGL03036:Kdm5b APN 1 134,536,675 (GRCm39) missense probably damaging 1.00
IGL03056:Kdm5b APN 1 134,515,717 (GRCm39) missense probably damaging 0.99
IGL03206:Kdm5b APN 1 134,555,055 (GRCm39) missense probably benign
IGL03342:Kdm5b APN 1 134,530,314 (GRCm39) missense probably benign 0.00
IGL03388:Kdm5b APN 1 134,555,060 (GRCm39) missense probably benign
amaryllis UTSW 1 134,536,799 (GRCm39) critical splice donor site probably null
PIT4486001:Kdm5b UTSW 1 134,556,423 (GRCm39) missense probably damaging 1.00
R0233:Kdm5b UTSW 1 134,532,372 (GRCm39) splice site probably benign
R0334:Kdm5b UTSW 1 134,532,260 (GRCm39) missense probably damaging 0.99
R0504:Kdm5b UTSW 1 134,548,761 (GRCm39) critical splice donor site probably null
R0505:Kdm5b UTSW 1 134,530,309 (GRCm39) missense probably damaging 0.96
R0521:Kdm5b UTSW 1 134,545,771 (GRCm39) missense possibly damaging 0.65
R1004:Kdm5b UTSW 1 134,516,642 (GRCm39) missense possibly damaging 0.71
R1087:Kdm5b UTSW 1 134,528,375 (GRCm39) missense probably damaging 1.00
R1126:Kdm5b UTSW 1 134,541,729 (GRCm39) missense possibly damaging 0.90
R1221:Kdm5b UTSW 1 134,526,829 (GRCm39) missense probably damaging 0.98
R1230:Kdm5b UTSW 1 134,540,992 (GRCm39) missense probably damaging 1.00
R1345:Kdm5b UTSW 1 134,558,288 (GRCm39) missense possibly damaging 0.94
R1482:Kdm5b UTSW 1 134,552,635 (GRCm39) missense probably damaging 1.00
R1582:Kdm5b UTSW 1 134,552,591 (GRCm39) missense probably damaging 0.99
R1653:Kdm5b UTSW 1 134,530,219 (GRCm39) missense probably damaging 1.00
R1693:Kdm5b UTSW 1 134,525,314 (GRCm39) splice site probably benign
R1721:Kdm5b UTSW 1 134,540,919 (GRCm39) splice site probably benign
R1741:Kdm5b UTSW 1 134,545,755 (GRCm39) missense possibly damaging 0.82
R1762:Kdm5b UTSW 1 134,532,205 (GRCm39) nonsense probably null
R1820:Kdm5b UTSW 1 134,525,408 (GRCm39) missense possibly damaging 0.87
R1872:Kdm5b UTSW 1 134,552,732 (GRCm39) missense probably damaging 1.00
R1966:Kdm5b UTSW 1 134,541,611 (GRCm39) splice site probably null
R2056:Kdm5b UTSW 1 134,540,952 (GRCm39) missense probably benign 0.05
R2059:Kdm5b UTSW 1 134,540,952 (GRCm39) missense probably benign 0.05
R2405:Kdm5b UTSW 1 134,536,754 (GRCm39) missense probably damaging 0.97
R3417:Kdm5b UTSW 1 134,515,715 (GRCm39) missense probably damaging 1.00
R3771:Kdm5b UTSW 1 134,541,083 (GRCm39) missense probably damaging 1.00
R3783:Kdm5b UTSW 1 134,558,280 (GRCm39) missense probably benign
R3803:Kdm5b UTSW 1 134,543,679 (GRCm39) missense probably benign 0.07
R3980:Kdm5b UTSW 1 134,547,408 (GRCm39) missense probably benign 0.11
R3983:Kdm5b UTSW 1 134,559,042 (GRCm39) missense possibly damaging 0.91
R4013:Kdm5b UTSW 1 134,555,067 (GRCm39) missense possibly damaging 0.86
R4162:Kdm5b UTSW 1 134,552,899 (GRCm39) missense probably benign 0.01
R4701:Kdm5b UTSW 1 134,533,750 (GRCm39) intron probably benign
R4791:Kdm5b UTSW 1 134,558,538 (GRCm39) missense possibly damaging 0.82
R4836:Kdm5b UTSW 1 134,521,053 (GRCm39) splice site probably null
R4924:Kdm5b UTSW 1 134,559,089 (GRCm39) missense probably benign 0.00
R5135:Kdm5b UTSW 1 134,516,484 (GRCm39) intron probably benign
R5248:Kdm5b UTSW 1 134,548,735 (GRCm39) missense probably benign 0.11
R5290:Kdm5b UTSW 1 134,549,837 (GRCm39) splice site probably null
R5358:Kdm5b UTSW 1 134,535,432 (GRCm39) nonsense probably null
R5388:Kdm5b UTSW 1 134,536,635 (GRCm39) nonsense probably null
R5396:Kdm5b UTSW 1 134,549,836 (GRCm39) splice site probably null
R5397:Kdm5b UTSW 1 134,549,836 (GRCm39) splice site probably null
R5398:Kdm5b UTSW 1 134,549,836 (GRCm39) splice site probably null
R5399:Kdm5b UTSW 1 134,549,836 (GRCm39) splice site probably null
R5529:Kdm5b UTSW 1 134,515,741 (GRCm39) missense probably damaging 1.00
R5540:Kdm5b UTSW 1 134,558,979 (GRCm39) missense probably damaging 0.98
R5661:Kdm5b UTSW 1 134,526,811 (GRCm39) missense probably benign 0.01
R5663:Kdm5b UTSW 1 134,558,373 (GRCm39) missense probably benign
R5822:Kdm5b UTSW 1 134,516,511 (GRCm39) splice site probably benign
R6226:Kdm5b UTSW 1 134,536,616 (GRCm39) missense probably damaging 0.99
R6368:Kdm5b UTSW 1 134,526,945 (GRCm39) missense probably damaging 1.00
R6681:Kdm5b UTSW 1 134,541,007 (GRCm39) missense possibly damaging 0.90
R6715:Kdm5b UTSW 1 134,536,799 (GRCm39) critical splice donor site probably null
R7132:Kdm5b UTSW 1 134,526,844 (GRCm39) missense probably damaging 1.00
R7258:Kdm5b UTSW 1 134,548,759 (GRCm39) missense probably damaging 1.00
R7335:Kdm5b UTSW 1 134,488,177 (GRCm39) missense probably damaging 1.00
R7420:Kdm5b UTSW 1 134,532,235 (GRCm39) missense probably benign 0.14
R7426:Kdm5b UTSW 1 134,523,571 (GRCm39) missense probably benign 0.02
R7452:Kdm5b UTSW 1 134,552,686 (GRCm39) missense probably damaging 1.00
R7595:Kdm5b UTSW 1 134,536,704 (GRCm39) missense probably benign 0.00
R7612:Kdm5b UTSW 1 134,552,656 (GRCm39) nonsense probably null
R7704:Kdm5b UTSW 1 134,515,669 (GRCm39) missense probably damaging 1.00
R7846:Kdm5b UTSW 1 134,545,578 (GRCm39) missense probably damaging 1.00
R8115:Kdm5b UTSW 1 134,547,411 (GRCm39) missense possibly damaging 0.83
R8146:Kdm5b UTSW 1 134,552,864 (GRCm39) missense probably benign 0.05
R8160:Kdm5b UTSW 1 134,541,657 (GRCm39) missense probably damaging 1.00
R8527:Kdm5b UTSW 1 134,533,512 (GRCm39) missense possibly damaging 0.78
R8542:Kdm5b UTSW 1 134,533,512 (GRCm39) missense possibly damaging 0.78
R8930:Kdm5b UTSW 1 134,544,010 (GRCm39) missense probably damaging 1.00
R8932:Kdm5b UTSW 1 134,544,010 (GRCm39) missense probably damaging 1.00
R8950:Kdm5b UTSW 1 134,541,664 (GRCm39) missense possibly damaging 0.84
R9089:Kdm5b UTSW 1 134,535,506 (GRCm39) missense probably damaging 0.98
R9109:Kdm5b UTSW 1 134,528,493 (GRCm39) critical splice donor site probably null
R9133:Kdm5b UTSW 1 134,530,323 (GRCm39) missense probably benign
R9298:Kdm5b UTSW 1 134,528,493 (GRCm39) critical splice donor site probably null
R9423:Kdm5b UTSW 1 134,515,705 (GRCm39) missense possibly damaging 0.85
R9630:Kdm5b UTSW 1 134,512,971 (GRCm39) critical splice donor site probably null
R9670:Kdm5b UTSW 1 134,558,240 (GRCm39) nonsense probably null
X0063:Kdm5b UTSW 1 134,516,614 (GRCm39) missense probably benign 0.07
Z1176:Kdm5b UTSW 1 134,552,773 (GRCm39) missense probably damaging 1.00
Z1177:Kdm5b UTSW 1 134,523,536 (GRCm39) frame shift probably null
Predicted Primers PCR Primer
(F):5'- TGCTTTGGACTGGAATGCAG -3'
(R):5'- CCAGCAGAGGCAGAATTTTC -3'

Sequencing Primer
(F):5'- GACTGGAATGCAGATAGGTTCTACTC -3'
(R):5'- GCAGAGGCAGAATTTTCTCTAATGG -3'
Posted On 2019-06-26