Incidental Mutation 'R0592:Dzip1'
ID56035
Institutional Source Beutler Lab
Gene Symbol Dzip1
Ensembl Gene ENSMUSG00000042156
Gene NameDAZ interacting protein 1
Synonyms2510025K24Rik, 2810422M04Rik
MMRRC Submission 038782-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.448) question?
Stock #R0592 (G1)
Quality Score186
Status Validated
Chromosome14
Chromosomal Location118875520-118925460 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 118902139 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Glycine at position 381 (E381G)
Ref Sequence ENSEMBL: ENSMUSP00000039689 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000004055] [ENSMUST00000047208]
Predicted Effect probably damaging
Transcript: ENSMUST00000004055
AA Change: E381G

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000004055
Gene: ENSMUSG00000042156
AA Change: E381G

DomainStartEndE-ValueType
Pfam:Dzip-like_N 43 163 3.6e-45 PFAM
ZnF_C2H2 183 206 2.09e-3 SMART
coiled coil region 214 249 N/A INTRINSIC
coiled coil region 276 303 N/A INTRINSIC
coiled coil region 385 427 N/A INTRINSIC
low complexity region 451 463 N/A INTRINSIC
low complexity region 481 496 N/A INTRINSIC
low complexity region 661 673 N/A INTRINSIC
low complexity region 781 795 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000047208
AA Change: E381G

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000039689
Gene: ENSMUSG00000042156
AA Change: E381G

DomainStartEndE-ValueType
Pfam:Dzip-like_N 43 163 3.7e-46 PFAM
ZnF_C2H2 183 206 2.09e-3 SMART
coiled coil region 214 249 N/A INTRINSIC
coiled coil region 276 303 N/A INTRINSIC
coiled coil region 385 427 N/A INTRINSIC
low complexity region 451 463 N/A INTRINSIC
low complexity region 481 496 N/A INTRINSIC
low complexity region 661 673 N/A INTRINSIC
low complexity region 781 795 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000226960
Predicted Effect noncoding transcript
Transcript: ENSMUST00000227344
Predicted Effect noncoding transcript
Transcript: ENSMUST00000228157
Predicted Effect noncoding transcript
Transcript: ENSMUST00000228540
Meta Mutation Damage Score 0.1135 question?
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.9%
  • 10x: 97.5%
  • 20x: 95.0%
Validation Efficiency 100% (35/35)
MGI Phenotype FUNCTION: This gene encodes a zinc finger protein that has been demonstrated to interact with the deleted in azoospermia (DAZ) protein. DAZ plays an important role early in germ cell development to maintain the initial germ cell population. Deletion of this gene in mice compromises Hedgehog signaling during embryogenesis. Mouse embryos lacking the encoded protein show severe developmental defects with dorsalized neural tubes and underdeveloped somites. Alternative splicing of this gene results in multiple transcript variants. A pseudogene for this gene has been identified on chromosome 5. [provided by RefSeq, Jan 2015]
PHENOTYPE: Mice homozygous for a targeted allele lacking exons 2 and 3 exhibit partial embryonic lethality around E9.5, decreased embryo size, underdevelopment of the neural tube and somite and lack of primary cilia on MEFs. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 35 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Atg2a GCCTTCCTTCCTTCCTTCCTTCCTTCCTTCCTTCC GCCTTCCTTCCTTCCTTCCTTCCTTCCTTCCTTCCTTCC 19: 6,245,007 probably benign Het
Bbs7 A T 3: 36,610,297 V53D probably benign Het
Bglap T A 3: 88,383,655 I90F probably benign Het
C2cd4b G A 9: 67,760,691 R323H probably damaging Het
Cdh5 T A 8: 104,130,902 probably null Het
Cdh8 T A 8: 99,279,478 D159V probably damaging Het
Dnah7a A G 1: 53,456,612 Y3229H possibly damaging Het
Elmod1 A G 9: 53,926,106 probably benign Het
Exosc10 T C 4: 148,581,113 S811P probably benign Het
Fhl3 A G 4: 124,705,677 Y15C probably benign Het
Gstz1 G A 12: 87,163,721 S126N probably benign Het
Hey2 C A 10: 30,833,957 A267S probably benign Het
Iqce A T 5: 140,686,107 probably null Het
Katnal2 A T 18: 77,002,560 probably null Het
Kdm2b G A 5: 122,961,134 probably benign Het
Mov10l1 A G 15: 88,998,766 probably null Het
Numa1 A G 7: 102,013,897 T724A probably benign Het
Oas3 A G 5: 120,771,149 F244S probably damaging Het
Olfr1472 T C 19: 13,453,705 I271V probably benign Het
Olfr715 G A 7: 107,129,343 L17F probably benign Het
Ppil2 A G 16: 17,107,219 S30P probably benign Het
Rab37 T G 11: 115,160,523 probably benign Het
Riox2 T C 16: 59,489,579 probably benign Het
Ryr3 A G 2: 112,678,481 S3358P probably damaging Het
Sash1 T A 10: 8,729,782 H948L probably benign Het
Serpinb6e T A 13: 33,841,074 N78I probably damaging Het
Slc25a47 G A 12: 108,854,258 V63M probably damaging Het
Slc9b1 A T 3: 135,394,074 probably benign Het
Strip2 T A 6: 29,931,210 S387T probably benign Het
Tcaf3 T C 6: 42,596,843 N145S probably benign Het
Tex10 C T 4: 48,456,800 R637Q probably benign Het
Trmu T C 15: 85,896,826 probably benign Het
Vezf1 A T 11: 88,068,435 probably benign Het
Vmn2r116 C T 17: 23,386,915 T267I probably damaging Het
Whrn C A 4: 63,415,567 A450S probably damaging Het
Other mutations in Dzip1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00495:Dzip1 APN 14 118883394 missense probably benign 0.41
IGL01534:Dzip1 APN 14 118877239 missense probably damaging 1.00
IGL01617:Dzip1 APN 14 118881065 missense probably benign 0.16
IGL02537:Dzip1 APN 14 118909576 splice site probably benign
IGL02801:Dzip1 APN 14 118885655 nonsense probably null
IGL03354:Dzip1 APN 14 118912569 splice site probably benign
PIT4151001:Dzip1 UTSW 14 118922788 missense probably damaging 1.00
R0325:Dzip1 UTSW 14 118909557 missense probably damaging 0.99
R0357:Dzip1 UTSW 14 118909538 missense probably damaging 0.99
R0942:Dzip1 UTSW 14 118887197 nonsense probably null
R1110:Dzip1 UTSW 14 118889305 missense probably benign 0.15
R1458:Dzip1 UTSW 14 118922713 missense probably benign 0.16
R1541:Dzip1 UTSW 14 118879478 missense probably damaging 1.00
R2046:Dzip1 UTSW 14 118922478 missense probably damaging 1.00
R2178:Dzip1 UTSW 14 118889404 splice site probably null
R2316:Dzip1 UTSW 14 118901540 missense probably benign 0.01
R2504:Dzip1 UTSW 14 118881044 missense probably benign 0.11
R2851:Dzip1 UTSW 14 118922445 missense possibly damaging 0.71
R2852:Dzip1 UTSW 14 118922445 missense possibly damaging 0.71
R3149:Dzip1 UTSW 14 118911368 missense probably benign 0.38
R4111:Dzip1 UTSW 14 118877233 nonsense probably null
R4349:Dzip1 UTSW 14 118883526 missense probably benign 0.00
R4350:Dzip1 UTSW 14 118883526 missense probably benign 0.00
R4351:Dzip1 UTSW 14 118883526 missense probably benign 0.00
R4352:Dzip1 UTSW 14 118883526 missense probably benign 0.00
R4868:Dzip1 UTSW 14 118877214 missense probably damaging 1.00
R5172:Dzip1 UTSW 14 118887151 missense probably damaging 0.97
R5191:Dzip1 UTSW 14 118911393 missense probably damaging 1.00
R5192:Dzip1 UTSW 14 118911393 missense probably damaging 1.00
R5376:Dzip1 UTSW 14 118911393 missense probably damaging 1.00
R5378:Dzip1 UTSW 14 118911393 missense probably damaging 1.00
R5655:Dzip1 UTSW 14 118887232 critical splice acceptor site probably null
R5816:Dzip1 UTSW 14 118909480 missense probably benign 0.00
R7256:Dzip1 UTSW 14 118885646 missense probably benign 0.00
R7768:Dzip1 UTSW 14 118879498 missense probably benign 0.11
R7788:Dzip1 UTSW 14 118883393 missense probably benign 0.00
X0009:Dzip1 UTSW 14 118877214 missense probably damaging 0.98
X0026:Dzip1 UTSW 14 118922457 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CAACTTCAGATGCCGGGACCTAAAC -3'
(R):5'- ACCTTTATCCTTAATCGCCGAGCAG -3'

Sequencing Primer
(F):5'- CCGGGACCTAAACCTGTG -3'
(R):5'- GTCTCATATCATAAACTCCCTGGAAG -3'
Posted On2013-07-11