Incidental Mutation 'R7202:Ndufaf1'
ID560351
Institutional Source Beutler Lab
Gene Symbol Ndufaf1
Ensembl Gene ENSMUSG00000027305
Gene NameNADH dehydrogenase (ubiquinone) 1 alpha subcomplex, assembly factor 1
SynonymsCGI-65, 2410001M24Rik, CIA30
MMRRC Submission
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.325) question?
Stock #R7202 (G1)
Quality Score225.009
Status Validated
Chromosome2
Chromosomal Location119655446-119662827 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 119658426 bp
ZygosityHeterozygous
Amino Acid Change Serine to Threonine at position 206 (S206T)
Ref Sequence ENSEMBL: ENSMUSP00000028768 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000028768] [ENSMUST00000110801] [ENSMUST00000110802]
Predicted Effect probably benign
Transcript: ENSMUST00000028768
AA Change: S206T

PolyPhen 2 Score 0.392 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000028768
Gene: ENSMUSG00000027305
AA Change: S206T

DomainStartEndE-ValueType
Pfam:CIA30 128 301 3e-51 PFAM
Pfam:CBM_11 193 315 1.7e-8 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000110801
AA Change: S204T

PolyPhen 2 Score 0.392 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000106425
Gene: ENSMUSG00000027305
AA Change: S204T

DomainStartEndE-ValueType
Pfam:CIA30 126 299 1.1e-47 PFAM
Pfam:CBM_11 127 312 1.3e-8 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000110802
AA Change: S204T

PolyPhen 2 Score 0.392 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000106426
Gene: ENSMUSG00000027305
AA Change: S204T

DomainStartEndE-ValueType
Pfam:CIA30 126 299 1.1e-47 PFAM
Pfam:CBM_11 127 312 1.3e-8 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency 99% (74/75)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a complex I assembly factor protein. Complex I (NADH-ubiquinone oxidoreductase) catalyzes the transfer of electrons from NADH to ubiquinone (coenzyme Q) in the first step of the mitochondrial respiratory chain, resulting in the translocation of protons across the inner mitochondrial membrane. The encoded protein is required for assembly of complex I, and mutations in this gene are a cause of mitochondrial complex I deficiency. Alternatively spliced transcript variants have been observed for this gene, and a pseudogene of this gene is located on the long arm of chromosome 19. [provided by RefSeq, Dec 2011]
Allele List at MGI
Other mutations in this stock
Total: 74 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca14 T C 7: 120,318,013 I1467T probably damaging Het
Adgrf3 T A 5: 30,204,380 K38* probably null Het
Ahdc1 T A 4: 133,061,887 C146* probably null Het
Ahnak A T 19: 9,017,799 K5482N probably damaging Het
AI464131 T C 4: 41,498,268 Y454C probably damaging Het
Arhgap23 C T 11: 97,451,993 A367V possibly damaging Het
Arvcf T C 16: 18,405,198 S960P probably damaging Het
Asb14 C A 14: 26,900,437 P74Q probably benign Het
Atad5 T C 11: 80,089,775 V2A probably damaging Het
Baz2a A G 10: 128,118,559 I691M possibly damaging Het
Brca2 A G 5: 150,532,354 T187A probably benign Het
Btbd11 A G 10: 85,387,765 E146G unknown Het
Calr4 T A 4: 109,244,057 N152K possibly damaging Het
Ccnb2 C T 9: 70,410,846 A215T probably damaging Het
Cdh16 C T 8: 104,614,148 D140N unknown Het
Ces1g T C 8: 93,302,967 T546A probably benign Het
Cfap74 G T 4: 155,426,197 probably null Het
Col5a1 G T 2: 27,952,378 D422Y unknown Het
Cyp2c66 A T 19: 39,141,904 Y61F probably damaging Het
Dnah12 G A 14: 26,778,912 probably null Het
Dnah6 A G 6: 73,181,705 probably null Het
Dopey1 T G 9: 86,504,167 probably null Het
Fam163a A G 1: 156,079,088 F106L probably damaging Het
Gfy T C 7: 45,178,172 T167A probably benign Het
Gm6525 A T 3: 84,175,034 R87S probably benign Het
Gramd1c C A 16: 44,059,221 A19S possibly damaging Het
Herc2 T C 7: 56,131,286 V1233A probably damaging Het
Hibch G A 1: 52,853,715 probably null Het
Ibsp A T 5: 104,302,161 S9C probably benign Het
Il17ra A G 6: 120,475,611 I252V probably benign Het
Ino80 A T 2: 119,374,437 M1536K probably benign Het
Ipo11 A T 13: 106,875,570 L568Q probably damaging Het
Kcnu1 T G 8: 25,919,581 probably null Het
Kdm5b T G 1: 134,624,759 S1158A probably benign Het
Kmt2a T C 9: 44,847,715 T946A probably benign Het
Kmt2e A T 5: 23,492,294 probably benign Het
Krba1 G A 6: 48,412,327 V594M probably damaging Het
Lamb1 T C 12: 31,324,315 L1559P probably damaging Het
Lig1 C T 7: 13,291,249 P227S probably benign Het
Lims2 T A 18: 31,956,964 D255E probably benign Het
Maats1 T C 16: 38,335,597 Y88C probably benign Het
March3 C T 18: 56,776,089 C208Y probably benign Het
Mei1 A G 15: 82,092,642 E142G Het
Melk G T 4: 44,351,106 R549L probably benign Het
Muc6 AGGCGCAGAAACCCTGGC AGGC 7: 141,634,450 probably null Het
Nae1 T C 8: 104,523,583 Y226C possibly damaging Het
Nap1l1 T C 10: 111,491,103 F175S probably damaging Het
Ndn T C 7: 62,348,961 L185P probably damaging Het
Ndst3 T A 3: 123,671,739 I195F possibly damaging Het
Nek10 C A 14: 14,836,171 H131N probably benign Het
Obsl1 T A 1: 75,489,716 D1456V possibly damaging Het
Olfr1328 C T 4: 118,934,018 V277I probably benign Het
Olfr605 T A 7: 103,443,085 T13S probably benign Het
Olfr714 A G 7: 107,074,241 N138D probably benign Het
Otog C T 7: 46,288,050 L1728F probably damaging Het
Pcx A T 19: 4,602,333 M150L possibly damaging Het
Pole A G 5: 110,297,107 D443G possibly damaging Het
Prr14 G T 7: 127,476,476 R552L probably damaging Het
Rasgrf1 T G 9: 90,017,072 S1156A possibly damaging Het
Rfc4 T A 16: 23,127,609 probably benign Het
Rfx5 G T 3: 94,958,961 A524S unknown Het
Ryr3 G A 2: 112,766,319 P2497S probably damaging Het
Scg3 T C 9: 75,683,710 T6A probably benign Het
Slc26a9 A T 1: 131,762,788 D510V possibly damaging Het
Stpg3 A G 2: 25,214,574 F10L probably damaging Het
Tmc5 T A 7: 118,639,956 H357Q possibly damaging Het
Tmem40 A T 6: 115,730,459 L253H probably damaging Het
Tmie A G 9: 110,867,564 V83A probably damaging Het
Uck2 A T 1: 167,226,515 I218N probably damaging Het
Vtn A G 11: 78,500,800 D310G possibly damaging Het
Wdr49 A T 3: 75,333,273 S430T probably benign Het
Wtip A G 7: 34,132,662 V133A probably benign Het
Zbtb9 T A 17: 26,974,692 V357E probably damaging Het
Zfp953 G A 13: 67,343,642 T82M probably benign Het
Other mutations in Ndufaf1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00551:Ndufaf1 APN 2 119660469 missense probably damaging 1.00
IGL01871:Ndufaf1 APN 2 119658287 nonsense probably null
IGL02452:Ndufaf1 APN 2 119656426 missense probably damaging 1.00
IGL03087:Ndufaf1 APN 2 119655799 splice site probably benign
R1211:Ndufaf1 UTSW 2 119655675 missense probably damaging 1.00
R2420:Ndufaf1 UTSW 2 119655737 missense probably damaging 1.00
R2421:Ndufaf1 UTSW 2 119655737 missense probably damaging 1.00
R2422:Ndufaf1 UTSW 2 119655737 missense probably damaging 1.00
R3824:Ndufaf1 UTSW 2 119660271 missense probably benign 0.30
R4942:Ndufaf1 UTSW 2 119660066 missense possibly damaging 0.83
R5382:Ndufaf1 UTSW 2 119660412 missense possibly damaging 0.75
R5460:Ndufaf1 UTSW 2 119660477 missense probably benign 0.02
R5732:Ndufaf1 UTSW 2 119660040 nonsense probably null
R5777:Ndufaf1 UTSW 2 119660482 nonsense probably null
R5919:Ndufaf1 UTSW 2 119660228 missense possibly damaging 0.51
R6371:Ndufaf1 UTSW 2 119660053 missense probably damaging 1.00
R6378:Ndufaf1 UTSW 2 119655726 missense probably damaging 0.99
R7224:Ndufaf1 UTSW 2 119658396 missense probably damaging 1.00
R7847:Ndufaf1 UTSW 2 119660053 missense probably damaging 1.00
R8208:Ndufaf1 UTSW 2 119660346 missense probably benign 0.01
R8319:Ndufaf1 UTSW 2 119660087 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AGATCCCATTTTCCTAACAGTGAAG -3'
(R):5'- GATGGGCAGGTTTACCTTGC -3'

Sequencing Primer
(F):5'- CCCATTTTCCTAACAGTGAAGAATTG -3'
(R):5'- GTTCTATCTTTGGAACCCACAAGG -3'
Posted On2019-06-26