Incidental Mutation 'R7202:Ibsp'
ID560362
Institutional Source Beutler Lab
Gene Symbol Ibsp
Ensembl Gene ENSMUSG00000029306
Gene Nameintegrin binding sialoprotein
SynonymsBsp2, bone sialoprotein, BSP
MMRRC Submission
Accession Numbers

Genbank: NM_008318.3

Is this an essential gene? Probably non essential (E-score: 0.096) question?
Stock #R7202 (G1)
Quality Score225.009
Status Validated
Chromosome5
Chromosomal Location104299171-104311469 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 104302161 bp
ZygosityHeterozygous
Amino Acid Change Serine to Cysteine at position 9 (S9C)
Ref Sequence ENSEMBL: ENSMUSP00000031246 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000031246]
Predicted Effect probably benign
Transcript: ENSMUST00000031246
AA Change: S9C

PolyPhen 2 Score 0.020 (Sensitivity: 0.95; Specificity: 0.80)
SMART Domains Protein: ENSMUSP00000031246
Gene: ENSMUSG00000029306
AA Change: S9C

DomainStartEndE-ValueType
signal peptide 1 16 N/A INTRINSIC
Pfam:BSP_II 17 321 2.8e-127 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency 99% (74/75)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a major structural protein of the bone matrix. It constitutes approximately 12% of the noncollagenous proteins in human bone and is synthesized by skeletal-associated cell types, including hypertrophic chondrocytes, osteoblasts, osteocytes, and osteoclasts. The only extraskeletal site of its synthesis is the trophoblast. This protein binds to calcium and hydroxyapatite via its acidic amino acid clusters, and mediates cell attachment through an RGD sequence that recognizes the vitronectin receptor. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a knock-out allele show reduced body weight/size, delayed long bone growth and mineralization with low bone turn over due to reduced osteoclast formation, delayed intramembranous ossification, progressive periodontal breakdown, and severe alveolar and mandibular bone loss. [provided by MGI curators]
Allele List at MGI

All alleles(3) : Targeted, knock-out(1) Targeted, other(2)

Other mutations in this stock
Total: 74 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca14 T C 7: 120,318,013 I1467T probably damaging Het
Adgrf3 T A 5: 30,204,380 K38* probably null Het
Ahdc1 T A 4: 133,061,887 C146* probably null Het
Ahnak A T 19: 9,017,799 K5482N probably damaging Het
AI464131 T C 4: 41,498,268 Y454C probably damaging Het
Arhgap23 C T 11: 97,451,993 A367V possibly damaging Het
Arvcf T C 16: 18,405,198 S960P probably damaging Het
Asb14 C A 14: 26,900,437 P74Q probably benign Het
Atad5 T C 11: 80,089,775 V2A probably damaging Het
Baz2a A G 10: 128,118,559 I691M possibly damaging Het
Brca2 A G 5: 150,532,354 T187A probably benign Het
Btbd11 A G 10: 85,387,765 E146G unknown Het
Calr4 T A 4: 109,244,057 N152K possibly damaging Het
Ccnb2 C T 9: 70,410,846 A215T probably damaging Het
Cdh16 C T 8: 104,614,148 D140N unknown Het
Ces1g T C 8: 93,302,967 T546A probably benign Het
Cfap74 G T 4: 155,426,197 probably null Het
Col5a1 G T 2: 27,952,378 D422Y unknown Het
Cyp2c66 A T 19: 39,141,904 Y61F probably damaging Het
Dnah12 G A 14: 26,778,912 probably null Het
Dnah6 A G 6: 73,181,705 probably null Het
Dopey1 T G 9: 86,504,167 probably null Het
Fam163a A G 1: 156,079,088 F106L probably damaging Het
Gfy T C 7: 45,178,172 T167A probably benign Het
Gm6525 A T 3: 84,175,034 R87S probably benign Het
Gramd1c C A 16: 44,059,221 A19S possibly damaging Het
Herc2 T C 7: 56,131,286 V1233A probably damaging Het
Hibch G A 1: 52,853,715 probably null Het
Il17ra A G 6: 120,475,611 I252V probably benign Het
Ino80 A T 2: 119,374,437 M1536K probably benign Het
Ipo11 A T 13: 106,875,570 L568Q probably damaging Het
Kcnu1 T G 8: 25,919,581 probably null Het
Kdm5b T G 1: 134,624,759 S1158A probably benign Het
Kmt2a T C 9: 44,847,715 T946A probably benign Het
Kmt2e A T 5: 23,492,294 probably benign Het
Krba1 G A 6: 48,412,327 V594M probably damaging Het
Lamb1 T C 12: 31,324,315 L1559P probably damaging Het
Lig1 C T 7: 13,291,249 P227S probably benign Het
Lims2 T A 18: 31,956,964 D255E probably benign Het
Maats1 T C 16: 38,335,597 Y88C probably benign Het
March3 C T 18: 56,776,089 C208Y probably benign Het
Mei1 A G 15: 82,092,642 E142G Het
Melk G T 4: 44,351,106 R549L probably benign Het
Muc6 AGGCGCAGAAACCCTGGC AGGC 7: 141,634,450 probably null Het
Nae1 T C 8: 104,523,583 Y226C possibly damaging Het
Nap1l1 T C 10: 111,491,103 F175S probably damaging Het
Ndn T C 7: 62,348,961 L185P probably damaging Het
Ndst3 T A 3: 123,671,739 I195F possibly damaging Het
Ndufaf1 A T 2: 119,658,426 S206T probably benign Het
Nek10 C A 14: 14,836,171 H131N probably benign Het
Obsl1 T A 1: 75,489,716 D1456V possibly damaging Het
Olfr1328 C T 4: 118,934,018 V277I probably benign Het
Olfr605 T A 7: 103,443,085 T13S probably benign Het
Olfr714 A G 7: 107,074,241 N138D probably benign Het
Otog C T 7: 46,288,050 L1728F probably damaging Het
Pcx A T 19: 4,602,333 M150L possibly damaging Het
Pole A G 5: 110,297,107 D443G possibly damaging Het
Prr14 G T 7: 127,476,476 R552L probably damaging Het
Rasgrf1 T G 9: 90,017,072 S1156A possibly damaging Het
Rfc4 T A 16: 23,127,609 probably benign Het
Rfx5 G T 3: 94,958,961 A524S unknown Het
Ryr3 G A 2: 112,766,319 P2497S probably damaging Het
Scg3 T C 9: 75,683,710 T6A probably benign Het
Slc26a9 A T 1: 131,762,788 D510V possibly damaging Het
Stpg3 A G 2: 25,214,574 F10L probably damaging Het
Tmc5 T A 7: 118,639,956 H357Q possibly damaging Het
Tmem40 A T 6: 115,730,459 L253H probably damaging Het
Tmie A G 9: 110,867,564 V83A probably damaging Het
Uck2 A T 1: 167,226,515 I218N probably damaging Het
Vtn A G 11: 78,500,800 D310G possibly damaging Het
Wdr49 A T 3: 75,333,273 S430T probably benign Het
Wtip A G 7: 34,132,662 V133A probably benign Het
Zbtb9 T A 17: 26,974,692 V357E probably damaging Het
Zfp953 G A 13: 67,343,642 T82M probably benign Het
Other mutations in Ibsp
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00687:Ibsp APN 5 104310068 missense probably benign 0.27
IGL02317:Ibsp APN 5 104302466 missense probably damaging 1.00
IGL02539:Ibsp APN 5 104302283 missense probably damaging 0.99
IGL03236:Ibsp APN 5 104306005 missense probably benign 0.30
crunch UTSW 5 104309282 missense probably damaging 1.00
I2289:Ibsp UTSW 5 104302487 missense possibly damaging 0.64
PIT4445001:Ibsp UTSW 5 104302304 missense possibly damaging 0.94
R0049:Ibsp UTSW 5 104302158 missense probably damaging 1.00
R0049:Ibsp UTSW 5 104302158 missense probably damaging 1.00
R0234:Ibsp UTSW 5 104310069 small deletion probably benign
R0610:Ibsp UTSW 5 104310134 missense probably benign 0.07
R0656:Ibsp UTSW 5 104310020 critical splice acceptor site probably null
R1168:Ibsp UTSW 5 104302152 missense probably damaging 0.99
R1440:Ibsp UTSW 5 104310539 missense unknown
R1569:Ibsp UTSW 5 104310151 missense probably damaging 1.00
R1921:Ibsp UTSW 5 104310212 missense probably damaging 1.00
R2172:Ibsp UTSW 5 104310430 missense probably damaging 1.00
R2879:Ibsp UTSW 5 104310394 missense possibly damaging 0.88
R4399:Ibsp UTSW 5 104309282 missense probably damaging 1.00
R4517:Ibsp UTSW 5 104305997 nonsense probably null
R5417:Ibsp UTSW 5 104310469 missense possibly damaging 0.95
R5575:Ibsp UTSW 5 104310059 missense possibly damaging 0.78
R6183:Ibsp UTSW 5 104306030 missense possibly damaging 0.95
R6273:Ibsp UTSW 5 104310301 missense probably benign 0.15
R6295:Ibsp UTSW 5 104302121 splice site probably null
R7061:Ibsp UTSW 5 104309902 splice site probably null
R7133:Ibsp UTSW 5 104302306 nonsense probably null
R7205:Ibsp UTSW 5 104310431 missense probably damaging 0.99
R7769:Ibsp UTSW 5 104306005 missense probably benign 0.15
R7769:Ibsp UTSW 5 104310184 missense probably damaging 0.97
R8506:Ibsp UTSW 5 104310081 missense probably damaging 1.00
R8840:Ibsp UTSW 5 104310140 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- CAGAGCTTTTCAGGACTAGGGG -3'
(R):5'- AATGGTCTGAAATCAGTTACCCCG -3'

Sequencing Primer
(F):5'- CTTTTCAGGACTAGGGGTCAAACAC -3'
(R):5'- GAAATCAGTTACCCCGTTTTCTTCAG -3'
Posted On2019-06-26