Incidental Mutation 'R0592:Mov10l1'
ID56037
Institutional Source Beutler Lab
Gene Symbol Mov10l1
Ensembl Gene ENSMUSG00000015365
Gene NameMoloney leukemia virus 10-like 1
SynonymsCsm, CHAMP
MMRRC Submission 038782-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.237) question?
Stock #R0592 (G1)
Quality Score133
Status Validated
Chromosome15
Chromosomal Location88982909-89055152 bp(+) (GRCm38)
Type of Mutationcritical splice acceptor site
DNA Base Change (assembly) A to G at 88998766 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000118437 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000015509] [ENSMUST00000146993]
Predicted Effect probably null
Transcript: ENSMUST00000015509
SMART Domains Protein: ENSMUSP00000015509
Gene: ENSMUSG00000015365

DomainStartEndE-ValueType
low complexity region 52 65 N/A INTRINSIC
low complexity region 338 349 N/A INTRINSIC
Blast:AAA 444 526 2e-7 BLAST
internal_repeat_1 615 651 5.23e-10 PROSPERO
internal_repeat_1 648 696 5.23e-10 PROSPERO
Pfam:AAA_11 746 852 1.4e-17 PFAM
Pfam:AAA_30 746 933 5e-11 PFAM
Pfam:AAA_19 754 826 1.5e-10 PFAM
Pfam:AAA_11 855 928 1.3e-18 PFAM
Pfam:AAA_12 935 1152 3.7e-44 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000146993
SMART Domains Protein: ENSMUSP00000118437
Gene: ENSMUSG00000015365

DomainStartEndE-ValueType
low complexity region 104 117 N/A INTRINSIC
low complexity region 390 401 N/A INTRINSIC
Blast:AAA 496 578 2e-7 BLAST
internal_repeat_1 667 703 6.08e-10 PROSPERO
internal_repeat_1 700 748 6.08e-10 PROSPERO
Pfam:AAA_11 798 903 1e-15 PFAM
Pfam:AAA_30 798 985 1.8e-11 PFAM
Pfam:AAA_19 806 878 7e-11 PFAM
Pfam:AAA_11 907 980 3.2e-17 PFAM
Pfam:AAA_12 987 1204 1.4e-43 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000156949
Meta Mutation Damage Score 0.9487 question?
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.9%
  • 10x: 97.5%
  • 20x: 95.0%
Validation Efficiency 100% (35/35)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is similar to a mouse gene that encodes a putative RNA helicase and shows testis-specific expression. Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Aug 2009]
PHENOTYPE: Mice homozygous for a targeted allele lacking the helicase domain exhibit male infertility due to meiotic arrest, apoptosis, and derepression of retrotransposons in male germ cells. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 35 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Atg2a GCCTTCCTTCCTTCCTTCCTTCCTTCCTTCCTTCC GCCTTCCTTCCTTCCTTCCTTCCTTCCTTCCTTCCTTCC 19: 6,245,007 probably benign Het
Bbs7 A T 3: 36,610,297 V53D probably benign Het
Bglap T A 3: 88,383,655 I90F probably benign Het
C2cd4b G A 9: 67,760,691 R323H probably damaging Het
Cdh5 T A 8: 104,130,902 probably null Het
Cdh8 T A 8: 99,279,478 D159V probably damaging Het
Dnah7a A G 1: 53,456,612 Y3229H possibly damaging Het
Dzip1 T C 14: 118,902,139 E381G probably damaging Het
Elmod1 A G 9: 53,926,106 probably benign Het
Exosc10 T C 4: 148,581,113 S811P probably benign Het
Fhl3 A G 4: 124,705,677 Y15C probably benign Het
Gstz1 G A 12: 87,163,721 S126N probably benign Het
Hey2 C A 10: 30,833,957 A267S probably benign Het
Iqce A T 5: 140,686,107 probably null Het
Katnal2 A T 18: 77,002,560 probably null Het
Kdm2b G A 5: 122,961,134 probably benign Het
Numa1 A G 7: 102,013,897 T724A probably benign Het
Oas3 A G 5: 120,771,149 F244S probably damaging Het
Olfr1472 T C 19: 13,453,705 I271V probably benign Het
Olfr715 G A 7: 107,129,343 L17F probably benign Het
Ppil2 A G 16: 17,107,219 S30P probably benign Het
Rab37 T G 11: 115,160,523 probably benign Het
Riox2 T C 16: 59,489,579 probably benign Het
Ryr3 A G 2: 112,678,481 S3358P probably damaging Het
Sash1 T A 10: 8,729,782 H948L probably benign Het
Serpinb6e T A 13: 33,841,074 N78I probably damaging Het
Slc25a47 G A 12: 108,854,258 V63M probably damaging Het
Slc9b1 A T 3: 135,394,074 probably benign Het
Strip2 T A 6: 29,931,210 S387T probably benign Het
Tcaf3 T C 6: 42,596,843 N145S probably benign Het
Tex10 C T 4: 48,456,800 R637Q probably benign Het
Trmu T C 15: 85,896,826 probably benign Het
Vezf1 A T 11: 88,068,435 probably benign Het
Vmn2r116 C T 17: 23,386,915 T267I probably damaging Het
Whrn C A 4: 63,415,567 A450S probably damaging Het
Other mutations in Mov10l1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00955:Mov10l1 APN 15 88994989 missense probably damaging 1.00
IGL01110:Mov10l1 APN 15 89021257 missense probably benign 0.05
IGL01369:Mov10l1 APN 15 89024837 splice site probably benign
IGL01531:Mov10l1 APN 15 89054352 missense probably damaging 0.99
IGL01712:Mov10l1 APN 15 89024766 missense probably damaging 0.98
IGL02330:Mov10l1 APN 15 89026490 missense probably damaging 1.00
IGL02540:Mov10l1 APN 15 89018211 missense probably benign
IGL02938:Mov10l1 APN 15 88988526 missense probably damaging 1.00
R0382:Mov10l1 UTSW 15 88985593 missense possibly damaging 0.96
R0437:Mov10l1 UTSW 15 89005312 missense probably damaging 0.96
R0504:Mov10l1 UTSW 15 88998839 missense probably damaging 1.00
R0538:Mov10l1 UTSW 15 88994860 missense possibly damaging 0.73
R0577:Mov10l1 UTSW 15 89005727 missense probably damaging 1.00
R0972:Mov10l1 UTSW 15 89021279 missense probably damaging 0.99
R1386:Mov10l1 UTSW 15 89011386 missense possibly damaging 0.87
R1737:Mov10l1 UTSW 15 89011404 missense possibly damaging 0.79
R2120:Mov10l1 UTSW 15 89007627 missense probably benign 0.30
R3740:Mov10l1 UTSW 15 89012142 missense possibly damaging 0.92
R3741:Mov10l1 UTSW 15 89012142 missense possibly damaging 0.92
R3846:Mov10l1 UTSW 15 89012142 missense possibly damaging 0.92
R3850:Mov10l1 UTSW 15 89005695 critical splice acceptor site probably null
R3964:Mov10l1 UTSW 15 89012163 missense probably benign 0.00
R3965:Mov10l1 UTSW 15 89012163 missense probably benign 0.00
R4049:Mov10l1 UTSW 15 88995032 splice site probably benign
R4836:Mov10l1 UTSW 15 89020269 missense possibly damaging 0.47
R5233:Mov10l1 UTSW 15 88983032 missense probably benign
R5466:Mov10l1 UTSW 15 88985701 critical splice donor site probably null
R5552:Mov10l1 UTSW 15 89054366 critical splice donor site probably null
R5780:Mov10l1 UTSW 15 89011978 missense probably benign
R6275:Mov10l1 UTSW 15 89026620 missense probably damaging 0.99
R6326:Mov10l1 UTSW 15 88994895 missense probably damaging 1.00
R6652:Mov10l1 UTSW 15 88993902 missense probably damaging 1.00
R6793:Mov10l1 UTSW 15 88996184 missense possibly damaging 0.86
R7278:Mov10l1 UTSW 15 88993868 missense probably benign 0.18
R7733:Mov10l1 UTSW 15 89024801 missense probably damaging 0.99
R7998:Mov10l1 UTSW 15 89053439 missense not run
Z1177:Mov10l1 UTSW 15 88996136 missense not run
Z1177:Mov10l1 UTSW 15 89018168 missense not run
Z1177:Mov10l1 UTSW 15 89053411 missense not run
Predicted Primers PCR Primer
(F):5'- GCCACCGTGGAAGCAAACAGTC -3'
(R):5'- ACATGTCTGCTGCCTGCCACAC -3'

Sequencing Primer
(F):5'- gtattcgttaccttgcctgttg -3'
(R):5'- TGTCTGCCTCTCCAGAACATATAAAG -3'
Posted On2013-07-11