Incidental Mutation 'R7202:Olfr605'
ID560375
Institutional Source Beutler Lab
Gene Symbol Olfr605
Ensembl Gene ENSMUSG00000109659
Gene Nameolfactory receptor 605
SynonymsGA_x6K02T2PBJ9-6164792-6163848, MOR24-5, MOR202-22P
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.202) question?
Stock #R7202 (G1)
Quality Score225.009
Status Validated
Chromosome7
Chromosomal Location103440407-103445439 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 103443085 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Serine at position 13 (T13S)
Ref Sequence ENSEMBL: ENSMUSP00000151125 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000080660] [ENSMUST00000215417]
Predicted Effect probably benign
Transcript: ENSMUST00000080660
AA Change: T13S

PolyPhen 2 Score 0.003 (Sensitivity: 0.98; Specificity: 0.44)
SMART Domains Protein: ENSMUSP00000079489
Gene: ENSMUSG00000109659
AA Change: T13S

DomainStartEndE-ValueType
Pfam:7tm_4 33 312 8.6e-105 PFAM
Pfam:7TM_GPCR_Srsx 37 305 1.9e-9 PFAM
Pfam:7tm_1 43 294 6.1e-14 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000215417
AA Change: T13S

PolyPhen 2 Score 0.003 (Sensitivity: 0.98; Specificity: 0.44)
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency 99% (74/75)
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 74 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca14 T C 7: 120,318,013 I1467T probably damaging Het
Adgrf3 T A 5: 30,204,380 K38* probably null Het
Ahdc1 T A 4: 133,061,887 C146* probably null Het
Ahnak A T 19: 9,017,799 K5482N probably damaging Het
AI464131 T C 4: 41,498,268 Y454C probably damaging Het
Arhgap23 C T 11: 97,451,993 A367V possibly damaging Het
Arvcf T C 16: 18,405,198 S960P probably damaging Het
Asb14 C A 14: 26,900,437 P74Q probably benign Het
Atad5 T C 11: 80,089,775 V2A probably damaging Het
Baz2a A G 10: 128,118,559 I691M possibly damaging Het
Brca2 A G 5: 150,532,354 T187A probably benign Het
Btbd11 A G 10: 85,387,765 E146G unknown Het
Calr4 T A 4: 109,244,057 N152K possibly damaging Het
Ccnb2 C T 9: 70,410,846 A215T probably damaging Het
Cdh16 C T 8: 104,614,148 D140N unknown Het
Ces1g T C 8: 93,302,967 T546A probably benign Het
Cfap74 G T 4: 155,426,197 probably null Het
Col5a1 G T 2: 27,952,378 D422Y unknown Het
Cyp2c66 A T 19: 39,141,904 Y61F probably damaging Het
Dnah12 G A 14: 26,778,912 probably null Het
Dnah6 A G 6: 73,181,705 probably null Het
Dopey1 T G 9: 86,504,167 probably null Het
Fam163a A G 1: 156,079,088 F106L probably damaging Het
Gfy T C 7: 45,178,172 T167A probably benign Het
Gm6525 A T 3: 84,175,034 R87S probably benign Het
Gramd1c C A 16: 44,059,221 A19S possibly damaging Het
Herc2 T C 7: 56,131,286 V1233A probably damaging Het
Hibch G A 1: 52,853,715 probably null Het
Ibsp A T 5: 104,302,161 S9C probably benign Het
Il17ra A G 6: 120,475,611 I252V probably benign Het
Ino80 A T 2: 119,374,437 M1536K probably benign Het
Ipo11 A T 13: 106,875,570 L568Q probably damaging Het
Kcnu1 T G 8: 25,919,581 probably null Het
Kdm5b T G 1: 134,624,759 S1158A probably benign Het
Kmt2a T C 9: 44,847,715 T946A probably benign Het
Kmt2e A T 5: 23,492,294 probably benign Het
Krba1 G A 6: 48,412,327 V594M probably damaging Het
Lamb1 T C 12: 31,324,315 L1559P probably damaging Het
Lig1 C T 7: 13,291,249 P227S probably benign Het
Lims2 T A 18: 31,956,964 D255E probably benign Het
Maats1 T C 16: 38,335,597 Y88C probably benign Het
March3 C T 18: 56,776,089 C208Y probably benign Het
Mei1 A G 15: 82,092,642 E142G Het
Melk G T 4: 44,351,106 R549L probably benign Het
Muc6 AGGCGCAGAAACCCTGGC AGGC 7: 141,634,450 probably null Het
Nae1 T C 8: 104,523,583 Y226C possibly damaging Het
Nap1l1 T C 10: 111,491,103 F175S probably damaging Het
Ndn T C 7: 62,348,961 L185P probably damaging Het
Ndst3 T A 3: 123,671,739 I195F possibly damaging Het
Ndufaf1 A T 2: 119,658,426 S206T probably benign Het
Nek10 C A 14: 14,836,171 H131N probably benign Het
Obsl1 T A 1: 75,489,716 D1456V possibly damaging Het
Olfr1328 C T 4: 118,934,018 V277I probably benign Het
Olfr714 A G 7: 107,074,241 N138D probably benign Het
Otog C T 7: 46,288,050 L1728F probably damaging Het
Pcx A T 19: 4,602,333 M150L possibly damaging Het
Pole A G 5: 110,297,107 D443G possibly damaging Het
Prr14 G T 7: 127,476,476 R552L probably damaging Het
Rasgrf1 T G 9: 90,017,072 S1156A possibly damaging Het
Rfc4 T A 16: 23,127,609 probably benign Het
Rfx5 G T 3: 94,958,961 A524S unknown Het
Ryr3 G A 2: 112,766,319 P2497S probably damaging Het
Scg3 T C 9: 75,683,710 T6A probably benign Het
Slc26a9 A T 1: 131,762,788 D510V possibly damaging Het
Stpg3 A G 2: 25,214,574 F10L probably damaging Het
Tmc5 T A 7: 118,639,956 H357Q possibly damaging Het
Tmem40 A T 6: 115,730,459 L253H probably damaging Het
Tmie A G 9: 110,867,564 V83A probably damaging Het
Uck2 A T 1: 167,226,515 I218N probably damaging Het
Vtn A G 11: 78,500,800 D310G possibly damaging Het
Wdr49 A T 3: 75,333,273 S430T probably benign Het
Wtip A G 7: 34,132,662 V133A probably benign Het
Zbtb9 T A 17: 26,974,692 V357E probably damaging Het
Zfp953 G A 13: 67,343,642 T82M probably benign Het
Other mutations in Olfr605
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02045:Olfr605 APN 7 103442952 missense probably damaging 1.00
IGL03219:Olfr605 APN 7 103442538 missense possibly damaging 0.51
IGL03265:Olfr605 APN 7 103442448 missense probably benign 0.18
IGL03404:Olfr605 APN 7 103442988 missense possibly damaging 0.78
R0294:Olfr605 UTSW 7 103443084 missense possibly damaging 0.77
R0465:Olfr605 UTSW 7 103442835 missense possibly damaging 0.67
R4698:Olfr605 UTSW 7 103442635 missense possibly damaging 0.88
R4758:Olfr605 UTSW 7 103442869 missense probably damaging 1.00
R5447:Olfr605 UTSW 7 103442940 missense probably damaging 0.99
R5595:Olfr605 UTSW 7 103442428 missense probably damaging 1.00
R7196:Olfr605 UTSW 7 103442997 missense probably benign 0.15
R7291:Olfr605 UTSW 7 103442788 missense probably benign 0.00
R7636:Olfr605 UTSW 7 103442833 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CATGCGTGGCAATGTAGATGTG -3'
(R):5'- CAGTTTGAGGAACCACTGCTC -3'

Sequencing Primer
(F):5'- CCAGGTCAGTGACAGACAGC -3'
(R):5'- TGAGGAACCACTGCTCTAATTAAAAC -3'
Posted On2019-06-26