Incidental Mutation 'R7202:Tmc5'
ID560377
Institutional Source Beutler Lab
Gene Symbol Tmc5
Ensembl Gene ENSMUSG00000030650
Gene Nametransmembrane channel-like gene family 5
Synonyms4932443L08Rik
MMRRC Submission
Accession Numbers

Genbank: NM_001105252.1, NM_028930.3

Is this an essential gene? Probably non essential (E-score: 0.099) question?
Stock #R7202 (G1)
Quality Score225.009
Status Validated
Chromosome7
Chromosomal Location118597297-118675086 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 118639956 bp
ZygosityHeterozygous
Amino Acid Change Histidine to Glutamine at position 357 (H357Q)
Ref Sequence ENSEMBL: ENSMUSP00000112434 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000057320] [ENSMUST00000098088] [ENSMUST00000121715] [ENSMUST00000121744]
Predicted Effect probably benign
Transcript: ENSMUST00000057320
AA Change: H147Q

PolyPhen 2 Score 0.031 (Sensitivity: 0.95; Specificity: 0.82)
SMART Domains Protein: ENSMUSP00000049784
Gene: ENSMUSG00000030650
AA Change: H147Q

DomainStartEndE-ValueType
transmembrane domain 203 225 N/A INTRINSIC
transmembrane domain 238 260 N/A INTRINSIC
transmembrane domain 275 297 N/A INTRINSIC
transmembrane domain 371 393 N/A INTRINSIC
transmembrane domain 408 430 N/A INTRINSIC
transmembrane domain 451 473 N/A INTRINSIC
Pfam:TMC 476 581 8.1e-44 PFAM
transmembrane domain 586 608 N/A INTRINSIC
transmembrane domain 652 674 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000098088
AA Change: H357Q

PolyPhen 2 Score 0.485 (Sensitivity: 0.88; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000095694
Gene: ENSMUSG00000030650
AA Change: H357Q

DomainStartEndE-ValueType
internal_repeat_1 7 105 2.08e-10 PROSPERO
internal_repeat_2 10 108 2.75e-10 PROSPERO
internal_repeat_2 127 234 2.75e-10 PROSPERO
internal_repeat_1 152 266 2.08e-10 PROSPERO
transmembrane domain 413 435 N/A INTRINSIC
transmembrane domain 448 470 N/A INTRINSIC
transmembrane domain 485 507 N/A INTRINSIC
transmembrane domain 581 603 N/A INTRINSIC
transmembrane domain 618 640 N/A INTRINSIC
transmembrane domain 661 683 N/A INTRINSIC
Pfam:TMC 686 791 1.2e-42 PFAM
transmembrane domain 796 818 N/A INTRINSIC
transmembrane domain 862 884 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000121715
AA Change: H357Q

PolyPhen 2 Score 0.485 (Sensitivity: 0.88; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000112434
Gene: ENSMUSG00000030650
AA Change: H357Q

DomainStartEndE-ValueType
internal_repeat_1 7 105 2.08e-10 PROSPERO
internal_repeat_2 10 108 2.75e-10 PROSPERO
internal_repeat_2 127 234 2.75e-10 PROSPERO
internal_repeat_1 152 266 2.08e-10 PROSPERO
transmembrane domain 413 435 N/A INTRINSIC
transmembrane domain 448 470 N/A INTRINSIC
transmembrane domain 485 507 N/A INTRINSIC
transmembrane domain 581 603 N/A INTRINSIC
transmembrane domain 618 640 N/A INTRINSIC
transmembrane domain 661 683 N/A INTRINSIC
Pfam:TMC 686 791 1.1e-43 PFAM
transmembrane domain 796 818 N/A INTRINSIC
transmembrane domain 862 884 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000121744
AA Change: H357Q

PolyPhen 2 Score 0.485 (Sensitivity: 0.88; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000114137
Gene: ENSMUSG00000030650
AA Change: H357Q

DomainStartEndE-ValueType
internal_repeat_1 7 105 2.08e-10 PROSPERO
internal_repeat_2 10 108 2.75e-10 PROSPERO
internal_repeat_2 127 234 2.75e-10 PROSPERO
internal_repeat_1 152 266 2.08e-10 PROSPERO
transmembrane domain 413 435 N/A INTRINSIC
transmembrane domain 448 470 N/A INTRINSIC
transmembrane domain 485 507 N/A INTRINSIC
transmembrane domain 581 603 N/A INTRINSIC
transmembrane domain 618 640 N/A INTRINSIC
transmembrane domain 661 683 N/A INTRINSIC
Pfam:TMC 686 791 1.1e-43 PFAM
transmembrane domain 796 818 N/A INTRINSIC
transmembrane domain 862 884 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency 99% (74/75)
Allele List at MGI

All alleles(5) : Gene trapped(5)

Other mutations in this stock
Total: 74 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca14 T C 7: 120,318,013 I1467T probably damaging Het
Adgrf3 T A 5: 30,204,380 K38* probably null Het
Ahdc1 T A 4: 133,061,887 C146* probably null Het
Ahnak A T 19: 9,017,799 K5482N probably damaging Het
AI464131 T C 4: 41,498,268 Y454C probably damaging Het
Arhgap23 C T 11: 97,451,993 A367V possibly damaging Het
Arvcf T C 16: 18,405,198 S960P probably damaging Het
Asb14 C A 14: 26,900,437 P74Q probably benign Het
Atad5 T C 11: 80,089,775 V2A probably damaging Het
Baz2a A G 10: 128,118,559 I691M possibly damaging Het
Brca2 A G 5: 150,532,354 T187A probably benign Het
Btbd11 A G 10: 85,387,765 E146G unknown Het
Calr4 T A 4: 109,244,057 N152K possibly damaging Het
Ccnb2 C T 9: 70,410,846 A215T probably damaging Het
Cdh16 C T 8: 104,614,148 D140N unknown Het
Ces1g T C 8: 93,302,967 T546A probably benign Het
Cfap74 G T 4: 155,426,197 probably null Het
Col5a1 G T 2: 27,952,378 D422Y unknown Het
Cyp2c66 A T 19: 39,141,904 Y61F probably damaging Het
Dnah12 G A 14: 26,778,912 probably null Het
Dnah6 A G 6: 73,181,705 probably null Het
Dopey1 T G 9: 86,504,167 probably null Het
Fam163a A G 1: 156,079,088 F106L probably damaging Het
Gfy T C 7: 45,178,172 T167A probably benign Het
Gm6525 A T 3: 84,175,034 R87S probably benign Het
Gramd1c C A 16: 44,059,221 A19S possibly damaging Het
Herc2 T C 7: 56,131,286 V1233A probably damaging Het
Hibch G A 1: 52,853,715 probably null Het
Ibsp A T 5: 104,302,161 S9C probably benign Het
Il17ra A G 6: 120,475,611 I252V probably benign Het
Ino80 A T 2: 119,374,437 M1536K probably benign Het
Ipo11 A T 13: 106,875,570 L568Q probably damaging Het
Kcnu1 T G 8: 25,919,581 probably null Het
Kdm5b T G 1: 134,624,759 S1158A probably benign Het
Kmt2a T C 9: 44,847,715 T946A probably benign Het
Kmt2e A T 5: 23,492,294 probably benign Het
Krba1 G A 6: 48,412,327 V594M probably damaging Het
Lamb1 T C 12: 31,324,315 L1559P probably damaging Het
Lig1 C T 7: 13,291,249 P227S probably benign Het
Lims2 T A 18: 31,956,964 D255E probably benign Het
Maats1 T C 16: 38,335,597 Y88C probably benign Het
March3 C T 18: 56,776,089 C208Y probably benign Het
Mei1 A G 15: 82,092,642 E142G Het
Melk G T 4: 44,351,106 R549L probably benign Het
Muc6 AGGCGCAGAAACCCTGGC AGGC 7: 141,634,450 probably null Het
Nae1 T C 8: 104,523,583 Y226C possibly damaging Het
Nap1l1 T C 10: 111,491,103 F175S probably damaging Het
Ndn T C 7: 62,348,961 L185P probably damaging Het
Ndst3 T A 3: 123,671,739 I195F possibly damaging Het
Ndufaf1 A T 2: 119,658,426 S206T probably benign Het
Nek10 C A 14: 14,836,171 H131N probably benign Het
Obsl1 T A 1: 75,489,716 D1456V possibly damaging Het
Olfr1328 C T 4: 118,934,018 V277I probably benign Het
Olfr605 T A 7: 103,443,085 T13S probably benign Het
Olfr714 A G 7: 107,074,241 N138D probably benign Het
Otog C T 7: 46,288,050 L1728F probably damaging Het
Pcx A T 19: 4,602,333 M150L possibly damaging Het
Pole A G 5: 110,297,107 D443G possibly damaging Het
Prr14 G T 7: 127,476,476 R552L probably damaging Het
Rasgrf1 T G 9: 90,017,072 S1156A possibly damaging Het
Rfc4 T A 16: 23,127,609 probably benign Het
Rfx5 G T 3: 94,958,961 A524S unknown Het
Ryr3 G A 2: 112,766,319 P2497S probably damaging Het
Scg3 T C 9: 75,683,710 T6A probably benign Het
Slc26a9 A T 1: 131,762,788 D510V possibly damaging Het
Stpg3 A G 2: 25,214,574 F10L probably damaging Het
Tmem40 A T 6: 115,730,459 L253H probably damaging Het
Tmie A G 9: 110,867,564 V83A probably damaging Het
Uck2 A T 1: 167,226,515 I218N probably damaging Het
Vtn A G 11: 78,500,800 D310G possibly damaging Het
Wdr49 A T 3: 75,333,273 S430T probably benign Het
Wtip A G 7: 34,132,662 V133A probably benign Het
Zbtb9 T A 17: 26,974,692 V357E probably damaging Het
Zfp953 G A 13: 67,343,642 T82M probably benign Het
Other mutations in Tmc5
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01484:Tmc5 APN 7 118656787 missense probably damaging 1.00
IGL01601:Tmc5 APN 7 118623824 unclassified probably benign
IGL01633:Tmc5 APN 7 118623586 missense probably damaging 0.97
IGL01845:Tmc5 APN 7 118652510 missense possibly damaging 0.93
IGL02148:Tmc5 APN 7 118645324 missense probably damaging 0.97
IGL02638:Tmc5 APN 7 118627233 missense probably benign 0.36
IGL02890:Tmc5 APN 7 118645430 splice site probably benign
hipster UTSW 7 118666611 critical splice donor site probably null
F5426:Tmc5 UTSW 7 118623323 missense probably benign
PIT4802001:Tmc5 UTSW 7 118672226 missense probably benign
R0068:Tmc5 UTSW 7 118634237 missense probably benign 0.44
R0470:Tmc5 UTSW 7 118639931 missense possibly damaging 0.68
R0520:Tmc5 UTSW 7 118666576 missense probably damaging 1.00
R0786:Tmc5 UTSW 7 118627210 missense possibly damaging 0.94
R1263:Tmc5 UTSW 7 118666870 missense probably damaging 1.00
R1269:Tmc5 UTSW 7 118666593 missense probably benign 0.30
R1486:Tmc5 UTSW 7 118673432 missense probably benign 0.02
R1702:Tmc5 UTSW 7 118672239 missense probably benign 0.00
R2188:Tmc5 UTSW 7 118654955 missense probably damaging 1.00
R3508:Tmc5 UTSW 7 118645395 missense probably benign 0.01
R3893:Tmc5 UTSW 7 118645369 missense probably damaging 1.00
R3927:Tmc5 UTSW 7 118652655 nonsense probably null
R4171:Tmc5 UTSW 7 118649587 missense probably damaging 0.99
R4279:Tmc5 UTSW 7 118674663 makesense probably null
R4554:Tmc5 UTSW 7 118670733 missense probably benign 0.16
R4555:Tmc5 UTSW 7 118670733 missense probably benign 0.16
R4557:Tmc5 UTSW 7 118670733 missense probably benign 0.16
R4833:Tmc5 UTSW 7 118628829 missense probably benign 0.11
R4845:Tmc5 UTSW 7 118642381 missense probably damaging 1.00
R4852:Tmc5 UTSW 7 118645339 missense probably benign 0.32
R5087:Tmc5 UTSW 7 118645386 missense possibly damaging 0.68
R5214:Tmc5 UTSW 7 118647932 missense probably damaging 1.00
R5723:Tmc5 UTSW 7 118672193 missense probably damaging 1.00
R5739:Tmc5 UTSW 7 118666611 critical splice donor site probably null
R5882:Tmc5 UTSW 7 118654919 missense probably damaging 0.99
R5946:Tmc5 UTSW 7 118670725 missense probably damaging 1.00
R6244:Tmc5 UTSW 7 118634214 missense possibly damaging 0.93
R6360:Tmc5 UTSW 7 118633966 start codon destroyed probably null 1.00
R6375:Tmc5 UTSW 7 118656814 missense probably damaging 1.00
R6458:Tmc5 UTSW 7 118645316 missense probably damaging 1.00
R6566:Tmc5 UTSW 7 118647844 missense probably damaging 1.00
R6681:Tmc5 UTSW 7 118669304 missense probably damaging 1.00
R7227:Tmc5 UTSW 7 118670666 missense possibly damaging 0.81
R7410:Tmc5 UTSW 7 118623597 nonsense probably null
R7562:Tmc5 UTSW 7 118623326 missense probably benign 0.10
R7808:Tmc5 UTSW 7 118669217 missense probably damaging 1.00
Z1177:Tmc5 UTSW 7 118623756 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CTTTGCTTGGACAATTCGACC -3'
(R):5'- TGTTAATGGAAACCTCGGCTG -3'

Sequencing Primer
(F):5'- GGAATCCAATGTTCCAGTGCC -3'
(R):5'- ACTATGTAGCCCTGGATAACCTG -3'
Posted On2019-06-26