Incidental Mutation 'R0592:Riox2'
ID56039
Institutional Source Beutler Lab
Gene Symbol Riox2
Ensembl Gene ENSMUSG00000022724
Gene Nameribosomal oxygenase 2
Synonyms3830408E23Rik, 1810047J07Rik, Mina, 2410057H13Rik
MMRRC Submission 038782-MU
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.738) question?
Stock #R0592 (G1)
Quality Score217
Status Validated
Chromosome16
Chromosomal Location59471775-59492461 bp(+) (GRCm38)
Type of Mutationunclassified
DNA Base Change (assembly) T to C at 59489579 bp
ZygosityHeterozygous
Amino Acid Change
Gene Model predicted gene model for transcript(s): [ENSMUST00000023407] [ENSMUST00000044604] [ENSMUST00000120674] [ENSMUST00000160571] [ENSMUST00000172910]
Predicted Effect probably benign
Transcript: ENSMUST00000023407
SMART Domains Protein: ENSMUSP00000023407
Gene: ENSMUSG00000022724

DomainStartEndE-ValueType
JmjC 127 273 1.33e-2 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000044604
SMART Domains Protein: ENSMUSP00000037682
Gene: ENSMUSG00000022723

DomainStartEndE-ValueType
low complexity region 258 273 N/A INTRINSIC
low complexity region 282 290 N/A INTRINSIC
XTALbg 430 516 2.78e-4 SMART
Pfam:Crystall 536 599 3.3e-7 PFAM
XTALbg 614 699 1.2e-21 SMART
XTALbg 707 790 5.73e-19 SMART
XTALbg 803 881 6.87e-5 SMART
XTALbg 889 969 1.28e-7 SMART
RICIN 972 1104 8.16e-14 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000120674
SMART Domains Protein: ENSMUSP00000112899
Gene: ENSMUSG00000022724

DomainStartEndE-ValueType
JmjC 127 273 1.33e-2 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000129762
Predicted Effect noncoding transcript
Transcript: ENSMUST00000131272
Predicted Effect probably benign
Transcript: ENSMUST00000160571
SMART Domains Protein: ENSMUSP00000125297
Gene: ENSMUSG00000022724

DomainStartEndE-ValueType
JmjC 127 273 1.33e-2 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000172910
Predicted Effect probably benign
Transcript: ENSMUST00000232544
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.9%
  • 10x: 97.5%
  • 20x: 95.0%
Validation Efficiency 100% (35/35)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] MINA is a c-Myc (MYC; MIM 190080) target gene that may play a role in cell proliferation or regulation of cell growth. (Tsuneoka et al., 2002 [PubMed 12091391]; Zhang et al., 2005 [PubMed 15897898]).[supplied by OMIM, May 2008]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit reduced allergic response to house dust mites. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 35 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Atg2a GCCTTCCTTCCTTCCTTCCTTCCTTCCTTCCTTCC GCCTTCCTTCCTTCCTTCCTTCCTTCCTTCCTTCCTTCC 19: 6,245,007 probably benign Het
Bbs7 A T 3: 36,610,297 V53D probably benign Het
Bglap T A 3: 88,383,655 I90F probably benign Het
C2cd4b G A 9: 67,760,691 R323H probably damaging Het
Cdh5 T A 8: 104,130,902 probably null Het
Cdh8 T A 8: 99,279,478 D159V probably damaging Het
Dnah7a A G 1: 53,456,612 Y3229H possibly damaging Het
Dzip1 T C 14: 118,902,139 E381G probably damaging Het
Elmod1 A G 9: 53,926,106 probably benign Het
Exosc10 T C 4: 148,581,113 S811P probably benign Het
Fhl3 A G 4: 124,705,677 Y15C probably benign Het
Gstz1 G A 12: 87,163,721 S126N probably benign Het
Hey2 C A 10: 30,833,957 A267S probably benign Het
Iqce A T 5: 140,686,107 probably null Het
Katnal2 A T 18: 77,002,560 probably null Het
Kdm2b G A 5: 122,961,134 probably benign Het
Mov10l1 A G 15: 88,998,766 probably null Het
Numa1 A G 7: 102,013,897 T724A probably benign Het
Oas3 A G 5: 120,771,149 F244S probably damaging Het
Olfr1472 T C 19: 13,453,705 I271V probably benign Het
Olfr715 G A 7: 107,129,343 L17F probably benign Het
Ppil2 A G 16: 17,107,219 S30P probably benign Het
Rab37 T G 11: 115,160,523 probably benign Het
Ryr3 A G 2: 112,678,481 S3358P probably damaging Het
Sash1 T A 10: 8,729,782 H948L probably benign Het
Serpinb6e T A 13: 33,841,074 N78I probably damaging Het
Slc25a47 G A 12: 108,854,258 V63M probably damaging Het
Slc9b1 A T 3: 135,394,074 probably benign Het
Strip2 T A 6: 29,931,210 S387T probably benign Het
Tcaf3 T C 6: 42,596,843 N145S probably benign Het
Tex10 C T 4: 48,456,800 R637Q probably benign Het
Trmu T C 15: 85,896,826 probably benign Het
Vezf1 A T 11: 88,068,435 probably benign Het
Vmn2r116 C T 17: 23,386,915 T267I probably damaging Het
Whrn C A 4: 63,415,567 A450S probably damaging Het
Other mutations in Riox2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02313:Riox2 APN 16 59489417 missense probably benign 0.03
IGL02580:Riox2 APN 16 59486573 missense probably benign 0.00
IGL03076:Riox2 APN 16 59491212 missense possibly damaging 0.68
R0009:Riox2 UTSW 16 59489367 missense probably benign 0.01
R0009:Riox2 UTSW 16 59489367 missense probably benign 0.01
R0322:Riox2 UTSW 16 59489389 nonsense probably null
R0620:Riox2 UTSW 16 59491892 missense probably benign 0.20
R1588:Riox2 UTSW 16 59475583 missense possibly damaging 0.46
R1623:Riox2 UTSW 16 59483042 missense probably damaging 1.00
R2863:Riox2 UTSW 16 59489393 missense probably damaging 0.99
R4113:Riox2 UTSW 16 59491894 missense probably benign 0.01
R4468:Riox2 UTSW 16 59475994 intron probably benign
R4708:Riox2 UTSW 16 59475682 missense probably benign 0.00
R4739:Riox2 UTSW 16 59489369 missense probably benign
R5074:Riox2 UTSW 16 59491873 missense possibly damaging 0.59
R5385:Riox2 UTSW 16 59486616 missense probably benign 0.33
Predicted Primers PCR Primer
(F):5'- CCCTGCTTTCCTTCAGAAGCAACAC -3'
(R):5'- CAAGCCAGTTTGGAGAATCAACGC -3'

Sequencing Primer
(F):5'- GATCACATTGTCCTCACAGTAGG -3'
(R):5'- CCAGTTTGGAGAATCAACGCATAAG -3'
Posted On2013-07-11