Incidental Mutation 'R7202:Baz2a'
ID560391
Institutional Source Beutler Lab
Gene Symbol Baz2a
Ensembl Gene ENSMUSG00000040054
Gene Namebromodomain adjacent to zinc finger domain, 2A
SynonymsC030005G16Rik, Tip5, Walp3
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R7202 (G1)
Quality Score225.009
Status Validated
Chromosome10
Chromosomal Location128091577-128129303 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 128118559 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Methionine at position 691 (I691M)
Ref Sequence ENSEMBL: ENSMUSP00000151308 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000045621] [ENSMUST00000170054] [ENSMUST00000217851] [ENSMUST00000219072] [ENSMUST00000220049]
Predicted Effect possibly damaging
Transcript: ENSMUST00000045621
AA Change: I691M

PolyPhen 2 Score 0.542 (Sensitivity: 0.88; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000044359
Gene: ENSMUSG00000040054
AA Change: I691M

DomainStartEndE-ValueType
low complexity region 73 82 N/A INTRINSIC
low complexity region 181 192 N/A INTRINSIC
low complexity region 342 353 N/A INTRINSIC
low complexity region 421 475 N/A INTRINSIC
low complexity region 518 529 N/A INTRINSIC
MBD 539 614 3.87e-35 SMART
AT_hook 639 651 2.38e0 SMART
AT_hook 660 672 1.65e0 SMART
low complexity region 697 710 N/A INTRINSIC
coiled coil region 736 776 N/A INTRINSIC
DDT 837 902 3.75e-18 SMART
Pfam:WHIM1 939 988 4.8e-8 PFAM
low complexity region 1001 1013 N/A INTRINSIC
AT_hook 1174 1186 6.23e1 SMART
AT_hook 1388 1400 4.21e0 SMART
Pfam:WHIM3 1423 1464 1e-9 PFAM
PHD 1662 1708 1.47e-11 SMART
low complexity region 1741 1753 N/A INTRINSIC
BROMO 1773 1881 7.71e-41 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000170054
AA Change: I692M

PolyPhen 2 Score 0.013 (Sensitivity: 0.96; Specificity: 0.78)
SMART Domains Protein: ENSMUSP00000129803
Gene: ENSMUSG00000040054
AA Change: I692M

DomainStartEndE-ValueType
low complexity region 73 82 N/A INTRINSIC
low complexity region 181 192 N/A INTRINSIC
low complexity region 343 354 N/A INTRINSIC
low complexity region 422 476 N/A INTRINSIC
low complexity region 519 530 N/A INTRINSIC
MBD 540 615 3.87e-35 SMART
AT_hook 640 652 2.38e0 SMART
AT_hook 661 673 1.65e0 SMART
low complexity region 698 711 N/A INTRINSIC
coiled coil region 737 777 N/A INTRINSIC
DDT 838 903 3.75e-18 SMART
Pfam:WHIM1 940 989 4.8e-8 PFAM
low complexity region 1002 1014 N/A INTRINSIC
AT_hook 1175 1187 6.23e1 SMART
AT_hook 1389 1401 4.21e0 SMART
Pfam:WHIM3 1424 1462 5.5e-19 PFAM
PHD 1663 1709 1.47e-11 SMART
low complexity region 1742 1754 N/A INTRINSIC
BROMO 1774 1882 7.71e-41 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000217851
AA Change: I694M

PolyPhen 2 Score 0.013 (Sensitivity: 0.96; Specificity: 0.78)
Predicted Effect possibly damaging
Transcript: ENSMUST00000219072
AA Change: I691M

PolyPhen 2 Score 0.542 (Sensitivity: 0.88; Specificity: 0.91)
Predicted Effect possibly damaging
Transcript: ENSMUST00000220049
AA Change: I691M

PolyPhen 2 Score 0.542 (Sensitivity: 0.88; Specificity: 0.91)
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency 99% (74/75)
Allele List at MGI
Other mutations in this stock
Total: 74 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca14 T C 7: 120,318,013 I1467T probably damaging Het
Adgrf3 T A 5: 30,204,380 K38* probably null Het
Ahdc1 T A 4: 133,061,887 C146* probably null Het
Ahnak A T 19: 9,017,799 K5482N probably damaging Het
AI464131 T C 4: 41,498,268 Y454C probably damaging Het
Arhgap23 C T 11: 97,451,993 A367V possibly damaging Het
Arvcf T C 16: 18,405,198 S960P probably damaging Het
Asb14 C A 14: 26,900,437 P74Q probably benign Het
Atad5 T C 11: 80,089,775 V2A probably damaging Het
Brca2 A G 5: 150,532,354 T187A probably benign Het
Btbd11 A G 10: 85,387,765 E146G unknown Het
Calr4 T A 4: 109,244,057 N152K possibly damaging Het
Ccnb2 C T 9: 70,410,846 A215T probably damaging Het
Cdh16 C T 8: 104,614,148 D140N unknown Het
Ces1g T C 8: 93,302,967 T546A probably benign Het
Cfap74 G T 4: 155,426,197 probably null Het
Col5a1 G T 2: 27,952,378 D422Y unknown Het
Cyp2c66 A T 19: 39,141,904 Y61F probably damaging Het
Dnah12 G A 14: 26,778,912 probably null Het
Dnah6 A G 6: 73,181,705 probably null Het
Dopey1 T G 9: 86,504,167 probably null Het
Fam163a A G 1: 156,079,088 F106L probably damaging Het
Gfy T C 7: 45,178,172 T167A probably benign Het
Gm6525 A T 3: 84,175,034 R87S probably benign Het
Gramd1c C A 16: 44,059,221 A19S possibly damaging Het
Herc2 T C 7: 56,131,286 V1233A probably damaging Het
Hibch G A 1: 52,853,715 probably null Het
Ibsp A T 5: 104,302,161 S9C probably benign Het
Il17ra A G 6: 120,475,611 I252V probably benign Het
Ino80 A T 2: 119,374,437 M1536K probably benign Het
Ipo11 A T 13: 106,875,570 L568Q probably damaging Het
Kcnu1 T G 8: 25,919,581 probably null Het
Kdm5b T G 1: 134,624,759 S1158A probably benign Het
Kmt2a T C 9: 44,847,715 T946A probably benign Het
Kmt2e A T 5: 23,492,294 probably benign Het
Krba1 G A 6: 48,412,327 V594M probably damaging Het
Lamb1 T C 12: 31,324,315 L1559P probably damaging Het
Lig1 C T 7: 13,291,249 P227S probably benign Het
Lims2 T A 18: 31,956,964 D255E probably benign Het
Maats1 T C 16: 38,335,597 Y88C probably benign Het
March3 C T 18: 56,776,089 C208Y probably benign Het
Mei1 A G 15: 82,092,642 E142G Het
Melk G T 4: 44,351,106 R549L probably benign Het
Muc6 AGGCGCAGAAACCCTGGC AGGC 7: 141,634,450 probably null Het
Nae1 T C 8: 104,523,583 Y226C possibly damaging Het
Nap1l1 T C 10: 111,491,103 F175S probably damaging Het
Ndn T C 7: 62,348,961 L185P probably damaging Het
Ndst3 T A 3: 123,671,739 I195F possibly damaging Het
Ndufaf1 A T 2: 119,658,426 S206T probably benign Het
Nek10 C A 14: 14,836,171 H131N probably benign Het
Obsl1 T A 1: 75,489,716 D1456V possibly damaging Het
Olfr1328 C T 4: 118,934,018 V277I probably benign Het
Olfr605 T A 7: 103,443,085 T13S probably benign Het
Olfr714 A G 7: 107,074,241 N138D probably benign Het
Otog C T 7: 46,288,050 L1728F probably damaging Het
Pcx A T 19: 4,602,333 M150L possibly damaging Het
Pole A G 5: 110,297,107 D443G possibly damaging Het
Prr14 G T 7: 127,476,476 R552L probably damaging Het
Rasgrf1 T G 9: 90,017,072 S1156A possibly damaging Het
Rfc4 T A 16: 23,127,609 probably benign Het
Rfx5 G T 3: 94,958,961 A524S unknown Het
Ryr3 G A 2: 112,766,319 P2497S probably damaging Het
Scg3 T C 9: 75,683,710 T6A probably benign Het
Slc26a9 A T 1: 131,762,788 D510V possibly damaging Het
Stpg3 A G 2: 25,214,574 F10L probably damaging Het
Tmc5 T A 7: 118,639,956 H357Q possibly damaging Het
Tmem40 A T 6: 115,730,459 L253H probably damaging Het
Tmie A G 9: 110,867,564 V83A probably damaging Het
Uck2 A T 1: 167,226,515 I218N probably damaging Het
Vtn A G 11: 78,500,800 D310G possibly damaging Het
Wdr49 A T 3: 75,333,273 S430T probably benign Het
Wtip A G 7: 34,132,662 V133A probably benign Het
Zbtb9 T A 17: 26,974,692 V357E probably damaging Het
Zfp953 G A 13: 67,343,642 T82M probably benign Het
Other mutations in Baz2a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00228:Baz2a APN 10 128124935 missense probably benign 0.00
IGL00501:Baz2a APN 10 128114625 missense probably benign 0.14
IGL00743:Baz2a APN 10 128114526 missense probably benign
IGL01362:Baz2a APN 10 128121964 missense probably damaging 0.98
IGL01394:Baz2a APN 10 128118645 missense possibly damaging 0.46
IGL01603:Baz2a APN 10 128111168 missense probably damaging 0.98
IGL02165:Baz2a APN 10 128119349 missense probably benign 0.03
IGL02732:Baz2a APN 10 128125175 missense possibly damaging 0.66
IGL03030:Baz2a APN 10 128125146 missense possibly damaging 0.62
IGL03087:Baz2a APN 10 128122313 missense probably damaging 0.99
R0255:Baz2a UTSW 10 128114639 missense possibly damaging 0.66
R0737:Baz2a UTSW 10 128116080 missense possibly damaging 0.92
R0742:Baz2a UTSW 10 128113666 nonsense probably null
R0755:Baz2a UTSW 10 128119691 missense possibly damaging 0.92
R0798:Baz2a UTSW 10 128126323 splice site probably benign
R0879:Baz2a UTSW 10 128121304 missense probably damaging 0.99
R1023:Baz2a UTSW 10 128121807 missense possibly damaging 0.66
R1482:Baz2a UTSW 10 128109008 missense possibly damaging 0.92
R1512:Baz2a UTSW 10 128124152 missense possibly damaging 0.95
R1658:Baz2a UTSW 10 128124383 missense probably benign 0.04
R1983:Baz2a UTSW 10 128123959 missense probably benign 0.14
R2059:Baz2a UTSW 10 128113578 missense probably damaging 0.98
R2141:Baz2a UTSW 10 128123612 missense probably damaging 1.00
R2921:Baz2a UTSW 10 128125077 frame shift probably null
R2922:Baz2a UTSW 10 128125077 frame shift probably null
R3104:Baz2a UTSW 10 128125077 frame shift probably null
R3105:Baz2a UTSW 10 128125077 frame shift probably null
R3106:Baz2a UTSW 10 128125077 frame shift probably null
R3621:Baz2a UTSW 10 128125077 frame shift probably null
R3872:Baz2a UTSW 10 128124110 missense probably damaging 1.00
R3873:Baz2a UTSW 10 128124110 missense probably damaging 1.00
R3875:Baz2a UTSW 10 128124110 missense probably damaging 1.00
R4600:Baz2a UTSW 10 128121183 missense probably damaging 0.97
R4692:Baz2a UTSW 10 128124893 missense probably damaging 1.00
R4717:Baz2a UTSW 10 128124942 missense possibly damaging 0.83
R4821:Baz2a UTSW 10 128111109 missense probably damaging 1.00
R4832:Baz2a UTSW 10 128123130 missense probably benign 0.08
R4893:Baz2a UTSW 10 128123415 missense possibly damaging 0.66
R4907:Baz2a UTSW 10 128110808 missense probably damaging 0.99
R5133:Baz2a UTSW 10 128116126 missense probably damaging 1.00
R5340:Baz2a UTSW 10 128115042 missense probably damaging 1.00
R5527:Baz2a UTSW 10 128124917 missense probably damaging 1.00
R5761:Baz2a UTSW 10 128119690 missense possibly damaging 0.66
R5891:Baz2a UTSW 10 128121322 missense probably damaging 1.00
R6088:Baz2a UTSW 10 128114642 small deletion probably benign
R6089:Baz2a UTSW 10 128114642 small deletion probably benign
R6323:Baz2a UTSW 10 128126417 missense probably benign 0.21
R6894:Baz2a UTSW 10 128123581 missense possibly damaging 0.81
R7101:Baz2a UTSW 10 128121187 missense possibly damaging 0.66
R7178:Baz2a UTSW 10 128124457 missense probably damaging 0.98
R7179:Baz2a UTSW 10 128124457 missense probably damaging 0.98
R7223:Baz2a UTSW 10 128112606 missense probably damaging 1.00
R7268:Baz2a UTSW 10 128124221 missense possibly damaging 0.66
R7426:Baz2a UTSW 10 128116078 missense probably damaging 1.00
R7464:Baz2a UTSW 10 128122073 missense possibly damaging 0.81
R7568:Baz2a UTSW 10 128125270 missense possibly damaging 0.83
R7672:Baz2a UTSW 10 128123857 missense possibly damaging 0.90
Predicted Primers PCR Primer
(F):5'- TGTGTGAGCGCTGTATACACC -3'
(R):5'- GCCTAAGGAATTCCACCTAGTG -3'

Sequencing Primer
(F):5'- TGTATACACCGCCTCAGCAGATG -3'
(R):5'- CCACCTAGTGAATGTGTACTGC -3'
Posted On2019-06-26