Incidental Mutation 'R7202:Arhgap23'
ID560394
Institutional Source Beutler Lab
Gene Symbol Arhgap23
Ensembl Gene ENSMUSG00000049807
Gene NameRho GTPase activating protein 23
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R7202 (G1)
Quality Score225.009
Status Validated
Chromosome11
Chromosomal Location97415533-97502402 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 97451993 bp
ZygosityHeterozygous
Amino Acid Change Alanine to Valine at position 367 (A367V)
Ref Sequence ENSEMBL: ENSMUSP00000112999 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000107601] [ENSMUST00000121799] [ENSMUST00000142465]
Predicted Effect possibly damaging
Transcript: ENSMUST00000107601
AA Change: A156V

PolyPhen 2 Score 0.650 (Sensitivity: 0.87; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000103227
Gene: ENSMUSG00000049807
AA Change: A156V

DomainStartEndE-ValueType
low complexity region 246 258 N/A INTRINSIC
low complexity region 354 369 N/A INTRINSIC
low complexity region 426 443 N/A INTRINSIC
PH 479 600 3.2e-12 SMART
low complexity region 679 687 N/A INTRINSIC
RhoGAP 707 884 6.83e-65 SMART
low complexity region 1051 1066 N/A INTRINSIC
low complexity region 1101 1114 N/A INTRINSIC
low complexity region 1125 1146 N/A INTRINSIC
low complexity region 1176 1194 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000121799
AA Change: A367V

PolyPhen 2 Score 0.650 (Sensitivity: 0.87; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000112999
Gene: ENSMUSG00000049807
AA Change: A367V

DomainStartEndE-ValueType
low complexity region 8 29 N/A INTRINSIC
PDZ 52 160 4.2e-17 SMART
low complexity region 457 469 N/A INTRINSIC
low complexity region 565 580 N/A INTRINSIC
low complexity region 637 654 N/A INTRINSIC
PH 690 811 3.2e-12 SMART
low complexity region 890 898 N/A INTRINSIC
RhoGAP 918 1095 6.83e-65 SMART
low complexity region 1262 1277 N/A INTRINSIC
low complexity region 1312 1325 N/A INTRINSIC
low complexity region 1336 1357 N/A INTRINSIC
low complexity region 1387 1405 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000142465
SMART Domains Protein: ENSMUSP00000123191
Gene: ENSMUSG00000049807

DomainStartEndE-ValueType
low complexity region 54 69 N/A INTRINSIC
low complexity region 126 143 N/A INTRINSIC
PH 179 300 3.2e-12 SMART
low complexity region 379 387 N/A INTRINSIC
RhoGAP 407 584 6.83e-65 SMART
Meta Mutation Damage Score 0.1006 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency 99% (74/75)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The RHO (see ARHA; MIM 165390) family of small GTPases are involved in signal transduction through transmembrane receptors, and they are inactive in the GDP-bound form and active in the GTP-bound form. GTPase-activating proteins, such as ARHGAP23, inactivate RHO family proteins by stimulating their hydrolysis of GTP (Katoh and Katoh, 2004 [PubMed 15254754]).[supplied by OMIM, Mar 2008]
Allele List at MGI
Other mutations in this stock
Total: 74 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca14 T C 7: 120,318,013 I1467T probably damaging Het
Adgrf3 T A 5: 30,204,380 K38* probably null Het
Ahdc1 T A 4: 133,061,887 C146* probably null Het
Ahnak A T 19: 9,017,799 K5482N probably damaging Het
AI464131 T C 4: 41,498,268 Y454C probably damaging Het
Arvcf T C 16: 18,405,198 S960P probably damaging Het
Asb14 C A 14: 26,900,437 P74Q probably benign Het
Atad5 T C 11: 80,089,775 V2A probably damaging Het
Baz2a A G 10: 128,118,559 I691M possibly damaging Het
Brca2 A G 5: 150,532,354 T187A probably benign Het
Btbd11 A G 10: 85,387,765 E146G unknown Het
Calr4 T A 4: 109,244,057 N152K possibly damaging Het
Ccnb2 C T 9: 70,410,846 A215T probably damaging Het
Cdh16 C T 8: 104,614,148 D140N unknown Het
Ces1g T C 8: 93,302,967 T546A probably benign Het
Cfap74 G T 4: 155,426,197 probably null Het
Col5a1 G T 2: 27,952,378 D422Y unknown Het
Cyp2c66 A T 19: 39,141,904 Y61F probably damaging Het
Dnah12 G A 14: 26,778,912 probably null Het
Dnah6 A G 6: 73,181,705 probably null Het
Dopey1 T G 9: 86,504,167 probably null Het
Fam163a A G 1: 156,079,088 F106L probably damaging Het
Gfy T C 7: 45,178,172 T167A probably benign Het
Gm6525 A T 3: 84,175,034 R87S probably benign Het
Gramd1c C A 16: 44,059,221 A19S possibly damaging Het
Herc2 T C 7: 56,131,286 V1233A probably damaging Het
Hibch G A 1: 52,853,715 probably null Het
Ibsp A T 5: 104,302,161 S9C probably benign Het
Il17ra A G 6: 120,475,611 I252V probably benign Het
Ino80 A T 2: 119,374,437 M1536K probably benign Het
Ipo11 A T 13: 106,875,570 L568Q probably damaging Het
Kcnu1 T G 8: 25,919,581 probably null Het
Kdm5b T G 1: 134,624,759 S1158A probably benign Het
Kmt2a T C 9: 44,847,715 T946A probably benign Het
Kmt2e A T 5: 23,492,294 probably benign Het
Krba1 G A 6: 48,412,327 V594M probably damaging Het
Lamb1 T C 12: 31,324,315 L1559P probably damaging Het
Lig1 C T 7: 13,291,249 P227S probably benign Het
Lims2 T A 18: 31,956,964 D255E probably benign Het
Maats1 T C 16: 38,335,597 Y88C probably benign Het
March3 C T 18: 56,776,089 C208Y probably benign Het
Mei1 A G 15: 82,092,642 E142G Het
Melk G T 4: 44,351,106 R549L probably benign Het
Muc6 AGGCGCAGAAACCCTGGC AGGC 7: 141,634,450 probably null Het
Nae1 T C 8: 104,523,583 Y226C possibly damaging Het
Nap1l1 T C 10: 111,491,103 F175S probably damaging Het
Ndn T C 7: 62,348,961 L185P probably damaging Het
Ndst3 T A 3: 123,671,739 I195F possibly damaging Het
Ndufaf1 A T 2: 119,658,426 S206T probably benign Het
Nek10 C A 14: 14,836,171 H131N probably benign Het
Obsl1 T A 1: 75,489,716 D1456V possibly damaging Het
Olfr1328 C T 4: 118,934,018 V277I probably benign Het
Olfr605 T A 7: 103,443,085 T13S probably benign Het
Olfr714 A G 7: 107,074,241 N138D probably benign Het
Otog C T 7: 46,288,050 L1728F probably damaging Het
Pcx A T 19: 4,602,333 M150L possibly damaging Het
Pole A G 5: 110,297,107 D443G possibly damaging Het
Prr14 G T 7: 127,476,476 R552L probably damaging Het
Rasgrf1 T G 9: 90,017,072 S1156A possibly damaging Het
Rfc4 T A 16: 23,127,609 probably benign Het
Rfx5 G T 3: 94,958,961 A524S unknown Het
Ryr3 G A 2: 112,766,319 P2497S probably damaging Het
Scg3 T C 9: 75,683,710 T6A probably benign Het
Slc26a9 A T 1: 131,762,788 D510V possibly damaging Het
Stpg3 A G 2: 25,214,574 F10L probably damaging Het
Tmc5 T A 7: 118,639,956 H357Q possibly damaging Het
Tmem40 A T 6: 115,730,459 L253H probably damaging Het
Tmie A G 9: 110,867,564 V83A probably damaging Het
Uck2 A T 1: 167,226,515 I218N probably damaging Het
Vtn A G 11: 78,500,800 D310G possibly damaging Het
Wdr49 A T 3: 75,333,273 S430T probably benign Het
Wtip A G 7: 34,132,662 V133A probably benign Het
Zbtb9 T A 17: 26,974,692 V357E probably damaging Het
Zfp953 G A 13: 67,343,642 T82M probably benign Het
Other mutations in Arhgap23
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00485:Arhgap23 APN 11 97492671 intron probably benign
IGL00493:Arhgap23 APN 11 97446553 critical splice donor site probably null
IGL01729:Arhgap23 APN 11 97453961 missense probably damaging 1.00
IGL01805:Arhgap23 APN 11 97492602 intron probably benign
IGL02005:Arhgap23 APN 11 97491219 missense probably damaging 0.99
IGL02026:Arhgap23 APN 11 97451581 missense probably damaging 0.99
IGL02135:Arhgap23 APN 11 97451702 missense probably damaging 0.97
IGL02178:Arhgap23 APN 11 97452353 missense probably benign 0.42
IGL02226:Arhgap23 APN 11 97451600 missense probably benign 0.07
IGL02309:Arhgap23 APN 11 97466001 splice site probably benign
IGL02399:Arhgap23 APN 11 97491005 intron probably benign
IGL02630:Arhgap23 APN 11 97454297 missense probably benign 0.24
IGL02724:Arhgap23 APN 11 97491179 missense probably damaging 0.99
IGL02740:Arhgap23 APN 11 97475017 missense probably damaging 1.00
IGL02746:Arhgap23 APN 11 97454204 splice site probably benign
IGL02862:Arhgap23 APN 11 97456480 missense probably damaging 1.00
IGL03380:Arhgap23 APN 11 97452518 missense probably damaging 1.00
R0091:Arhgap23 UTSW 11 97452244 missense probably benign 0.44
R0134:Arhgap23 UTSW 11 97444328 missense probably benign 0.09
R0225:Arhgap23 UTSW 11 97444328 missense probably benign 0.09
R0305:Arhgap23 UTSW 11 97501109 missense probably damaging 0.99
R0358:Arhgap23 UTSW 11 97463588 missense probably damaging 1.00
R0422:Arhgap23 UTSW 11 97463652 missense probably damaging 1.00
R0497:Arhgap23 UTSW 11 97452163 missense probably damaging 1.00
R0580:Arhgap23 UTSW 11 97446536 frame shift probably null
R0782:Arhgap23 UTSW 11 97500554 missense possibly damaging 0.73
R1216:Arhgap23 UTSW 11 97492672 intron probably benign
R1488:Arhgap23 UTSW 11 97500859 missense possibly damaging 0.53
R1785:Arhgap23 UTSW 11 97451561 missense possibly damaging 0.77
R1844:Arhgap23 UTSW 11 97463408 missense probably damaging 1.00
R1855:Arhgap23 UTSW 11 97448697 missense probably damaging 0.99
R1977:Arhgap23 UTSW 11 97451447 missense possibly damaging 0.95
R2064:Arhgap23 UTSW 11 97493062 missense probably benign 0.02
R2130:Arhgap23 UTSW 11 97451561 missense possibly damaging 0.77
R2431:Arhgap23 UTSW 11 97452404 missense probably benign
R2853:Arhgap23 UTSW 11 97492594 splice site probably null
R3767:Arhgap23 UTSW 11 97476106 missense probably damaging 1.00
R3768:Arhgap23 UTSW 11 97476106 missense probably damaging 1.00
R3769:Arhgap23 UTSW 11 97476106 missense probably damaging 1.00
R3770:Arhgap23 UTSW 11 97476106 missense probably damaging 1.00
R4209:Arhgap23 UTSW 11 97454496 missense probably damaging 0.99
R4247:Arhgap23 UTSW 11 97463699 missense probably damaging 1.00
R4997:Arhgap23 UTSW 11 97452020 missense probably damaging 0.98
R5399:Arhgap23 UTSW 11 97500917 missense probably damaging 0.97
R5549:Arhgap23 UTSW 11 97466568 missense probably damaging 0.96
R5655:Arhgap23 UTSW 11 97452546 critical splice donor site probably null
R5857:Arhgap23 UTSW 11 97451579 missense possibly damaging 0.93
R6013:Arhgap23 UTSW 11 97500992 missense probably damaging 0.99
R6031:Arhgap23 UTSW 11 97476139 missense probably damaging 1.00
R6031:Arhgap23 UTSW 11 97476139 missense probably damaging 1.00
R6077:Arhgap23 UTSW 11 97491232 critical splice donor site probably null
R6151:Arhgap23 UTSW 11 97500412 missense probably benign 0.01
R6393:Arhgap23 UTSW 11 97463672 missense probably damaging 0.98
R6693:Arhgap23 UTSW 11 97466517 missense probably damaging 1.00
R6752:Arhgap23 UTSW 11 97452248 missense probably damaging 0.98
R7209:Arhgap23 UTSW 11 97476085 missense probably damaging 1.00
R7209:Arhgap23 UTSW 11 97492447 splice site probably null
R7320:Arhgap23 UTSW 11 97451545 missense probably benign 0.10
R7345:Arhgap23 UTSW 11 97466478 missense possibly damaging 0.91
R7599:Arhgap23 UTSW 11 97500343 missense probably benign
R8229:Arhgap23 UTSW 11 97453906 missense probably benign 0.36
R8412:Arhgap23 UTSW 11 97466028 missense probably benign 0.02
R8460:Arhgap23 UTSW 11 97452371 missense probably damaging 1.00
R8492:Arhgap23 UTSW 11 97475021 missense probably damaging 1.00
R8525:Arhgap23 UTSW 11 97490084 missense probably damaging 1.00
R8692:Arhgap23 UTSW 11 97454496 missense probably damaging 0.99
R8708:Arhgap23 UTSW 11 97452412 missense probably benign 0.06
R8749:Arhgap23 UTSW 11 97500815 missense probably damaging 0.99
R8882:Arhgap23 UTSW 11 97465123 missense probably benign 0.00
RF020:Arhgap23 UTSW 11 97463561 missense probably damaging 1.00
V8831:Arhgap23 UTSW 11 97456545 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- TCACACTGGCTGTCCAATCAG -3'
(R):5'- GGCTATAGCTCCGATATCCAATG -3'

Sequencing Primer
(F):5'- TGGCTGTCCAATCAGATACCC -3'
(R):5'- ATGTACCCGATGTCATCCAGG -3'
Posted On2019-06-26