Incidental Mutation 'R0592:Katnal2'
ID56040
Institutional Source Beutler Lab
Gene Symbol Katnal2
Ensembl Gene ENSMUSG00000025420
Gene Namekatanin p60 subunit A-like 2
Synonyms4933439B08Rik, 3110023G01Rik
MMRRC Submission 038782-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R0592 (G1)
Quality Score115
Status Validated
Chromosome18
Chromosomal Location76977148-77047308 bp(-) (GRCm38)
Type of Mutationsplice site
DNA Base Change (assembly) A to T at 77002560 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000117495 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000026486] [ENSMUST00000122984] [ENSMUST00000126153] [ENSMUST00000135029] [ENSMUST00000137354] [ENSMUST00000137354] [ENSMUST00000137498] [ENSMUST00000137498]
Predicted Effect probably null
Transcript: ENSMUST00000026486
SMART Domains Protein: ENSMUSP00000026486
Gene: ENSMUSG00000025420

DomainStartEndE-ValueType
LisH 25 57 8.53e-6 SMART
AAA 287 400 6.46e-11 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000122984
Predicted Effect noncoding transcript
Transcript: ENSMUST00000125744
Predicted Effect probably null
Transcript: ENSMUST00000126153
SMART Domains Protein: ENSMUSP00000122079
Gene: ENSMUSG00000025420

DomainStartEndE-ValueType
LisH 25 57 8.53e-6 SMART
AAA 287 425 1.74e-16 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000135029
SMART Domains Protein: ENSMUSP00000115411
Gene: ENSMUSG00000025420

DomainStartEndE-ValueType
LisH 25 57 8.53e-6 SMART
AAA 287 372 2.95e-5 SMART
Predicted Effect probably null
Transcript: ENSMUST00000137354
SMART Domains Protein: ENSMUSP00000118511
Gene: ENSMUSG00000025420

DomainStartEndE-ValueType
AAA 25 163 1.74e-16 SMART
Predicted Effect probably null
Transcript: ENSMUST00000137354
SMART Domains Protein: ENSMUSP00000118511
Gene: ENSMUSG00000025420

DomainStartEndE-ValueType
AAA 25 163 1.74e-16 SMART
Predicted Effect probably null
Transcript: ENSMUST00000137498
SMART Domains Protein: ENSMUSP00000117495
Gene: ENSMUSG00000025420

DomainStartEndE-ValueType
AAA 243 381 1.74e-16 SMART
Predicted Effect probably null
Transcript: ENSMUST00000137498
SMART Domains Protein: ENSMUSP00000117495
Gene: ENSMUSG00000025420

DomainStartEndE-ValueType
AAA 243 381 1.74e-16 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000138336
Predicted Effect noncoding transcript
Transcript: ENSMUST00000154053
Meta Mutation Damage Score 0.9755 question?
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.9%
  • 10x: 97.5%
  • 20x: 95.0%
Validation Efficiency 100% (35/35)
Allele List at MGI
Other mutations in this stock
Total: 35 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Atg2a GCCTTCCTTCCTTCCTTCCTTCCTTCCTTCCTTCC GCCTTCCTTCCTTCCTTCCTTCCTTCCTTCCTTCCTTCC 19: 6,245,007 probably benign Het
Bbs7 A T 3: 36,610,297 V53D probably benign Het
Bglap T A 3: 88,383,655 I90F probably benign Het
C2cd4b G A 9: 67,760,691 R323H probably damaging Het
Cdh5 T A 8: 104,130,902 probably null Het
Cdh8 T A 8: 99,279,478 D159V probably damaging Het
Dnah7a A G 1: 53,456,612 Y3229H possibly damaging Het
Dzip1 T C 14: 118,902,139 E381G probably damaging Het
Elmod1 A G 9: 53,926,106 probably benign Het
Exosc10 T C 4: 148,581,113 S811P probably benign Het
Fhl3 A G 4: 124,705,677 Y15C probably benign Het
Gstz1 G A 12: 87,163,721 S126N probably benign Het
Hey2 C A 10: 30,833,957 A267S probably benign Het
Iqce A T 5: 140,686,107 probably null Het
Kdm2b G A 5: 122,961,134 probably benign Het
Mov10l1 A G 15: 88,998,766 probably null Het
Numa1 A G 7: 102,013,897 T724A probably benign Het
Oas3 A G 5: 120,771,149 F244S probably damaging Het
Olfr1472 T C 19: 13,453,705 I271V probably benign Het
Olfr715 G A 7: 107,129,343 L17F probably benign Het
Ppil2 A G 16: 17,107,219 S30P probably benign Het
Rab37 T G 11: 115,160,523 probably benign Het
Riox2 T C 16: 59,489,579 probably benign Het
Ryr3 A G 2: 112,678,481 S3358P probably damaging Het
Sash1 T A 10: 8,729,782 H948L probably benign Het
Serpinb6e T A 13: 33,841,074 N78I probably damaging Het
Slc25a47 G A 12: 108,854,258 V63M probably damaging Het
Slc9b1 A T 3: 135,394,074 probably benign Het
Strip2 T A 6: 29,931,210 S387T probably benign Het
Tcaf3 T C 6: 42,596,843 N145S probably benign Het
Tex10 C T 4: 48,456,800 R637Q probably benign Het
Trmu T C 15: 85,896,826 probably benign Het
Vezf1 A T 11: 88,068,435 probably benign Het
Vmn2r116 C T 17: 23,386,915 T267I probably damaging Het
Whrn C A 4: 63,415,567 A450S probably damaging Het
Other mutations in Katnal2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00886:Katnal2 APN 18 77002754 missense probably damaging 1.00
IGL00976:Katnal2 APN 18 77017493 missense probably damaging 1.00
IGL01012:Katnal2 APN 18 77017554 missense probably damaging 0.96
IGL01302:Katnal2 APN 18 77047167 splice site probably benign
IGL01377:Katnal2 APN 18 77002457 missense probably damaging 1.00
IGL01532:Katnal2 APN 18 77012000 missense probably benign
IGL03203:Katnal2 APN 18 77007524 missense probably damaging 1.00
R1348:Katnal2 UTSW 18 76978542 splice site probably null
R1419:Katnal2 UTSW 18 76977432 missense possibly damaging 0.85
R1755:Katnal2 UTSW 18 77012067 missense probably benign 0.01
R1772:Katnal2 UTSW 18 77002537 missense probably damaging 1.00
R1852:Katnal2 UTSW 18 77016023 missense probably benign 0.08
R1952:Katnal2 UTSW 18 76980011 missense probably benign 0.00
R2115:Katnal2 UTSW 18 76980091 missense probably damaging 1.00
R2155:Katnal2 UTSW 18 77010941 missense probably benign 0.01
R4765:Katnal2 UTSW 18 76977543 intron probably null
R5126:Katnal2 UTSW 18 77017598 missense probably benign 0.13
R5141:Katnal2 UTSW 18 76997641 missense probably damaging 1.00
R5315:Katnal2 UTSW 18 77012009 missense probably benign 0.02
R5358:Katnal2 UTSW 18 77017494 missense possibly damaging 0.47
R5412:Katnal2 UTSW 18 77002435 missense probably damaging 1.00
R6289:Katnal2 UTSW 18 77017455 unclassified probably null
R6647:Katnal2 UTSW 18 76980037 missense probably benign 0.01
R6919:Katnal2 UTSW 18 77011038 missense probably benign 0.05
R7039:Katnal2 UTSW 18 77047172 critical splice donor site probably null
R7285:Katnal2 UTSW 18 76993575 missense probably benign 0.20
Z1176:Katnal2 UTSW 18 77012057 missense not run
Predicted Primers PCR Primer
(F):5'- TGGTAGTCACAATCCAAGCGGAATC -3'
(R):5'- TTGTTCTCCAAGTACCCGCAGC -3'

Sequencing Primer
(F):5'- TCCAAGCGGAATCTAAGATATACATC -3'
(R):5'- GGAAAGGACTGCTGCTTTAC -3'
Posted On2013-07-11