Incidental Mutation 'R7202:Mei1'
ID560401
Institutional Source Beutler Lab
Gene Symbol Mei1
Ensembl Gene ENSMUSG00000068117
Gene Namemeiotic double-stranded break formation protein 1
Synonymsmei1
MMRRC Submission
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.343) question?
Stock #R7202 (G1)
Quality Score225.009
Status Validated
Chromosome15
Chromosomal Location82069996-82126814 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 82092642 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Glycine at position 142 (E142G)
Ref Sequence ENSEMBL: ENSMUSP00000140479 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000089178] [ENSMUST00000186125] [ENSMUST00000188048] [ENSMUST00000189540] [ENSMUST00000229119]
Predicted Effect
SMART Domains Protein: ENSMUSP00000086582
Gene: ENSMUSG00000068117
AA Change: E516G

DomainStartEndE-ValueType
low complexity region 13 30 N/A INTRINSIC
SCOP:d1gw5a_ 123 498 1e-3 SMART
low complexity region 956 966 N/A INTRINSIC
low complexity region 1025 1045 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000186125
AA Change: E142G

PolyPhen 2 Score 0.922 (Sensitivity: 0.81; Specificity: 0.94)
Predicted Effect
SMART Domains Protein: ENSMUSP00000139689
Gene: ENSMUSG00000068117
AA Change: E142G

DomainStartEndE-ValueType
low complexity region 523 536 N/A INTRINSIC
low complexity region 595 615 N/A INTRINSIC
Predicted Effect
SMART Domains Protein: ENSMUSP00000140479
Gene: ENSMUSG00000068117
AA Change: E142G

DomainStartEndE-ValueType
low complexity region 523 536 N/A INTRINSIC
low complexity region 595 615 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000229119
AA Change: E566G

PolyPhen 2 Score 0.816 (Sensitivity: 0.84; Specificity: 0.93)
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency 99% (74/75)
MGI Phenotype PHENOTYPE: Homozygous mutant mice of both sexes exhibit meiotic defects and are infertile. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 74 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca14 T C 7: 120,318,013 I1467T probably damaging Het
Adgrf3 T A 5: 30,204,380 K38* probably null Het
Ahdc1 T A 4: 133,061,887 C146* probably null Het
Ahnak A T 19: 9,017,799 K5482N probably damaging Het
AI464131 T C 4: 41,498,268 Y454C probably damaging Het
Arhgap23 C T 11: 97,451,993 A367V possibly damaging Het
Arvcf T C 16: 18,405,198 S960P probably damaging Het
Asb14 C A 14: 26,900,437 P74Q probably benign Het
Atad5 T C 11: 80,089,775 V2A probably damaging Het
Baz2a A G 10: 128,118,559 I691M possibly damaging Het
Brca2 A G 5: 150,532,354 T187A probably benign Het
Btbd11 A G 10: 85,387,765 E146G unknown Het
Calr4 T A 4: 109,244,057 N152K possibly damaging Het
Ccnb2 C T 9: 70,410,846 A215T probably damaging Het
Cdh16 C T 8: 104,614,148 D140N unknown Het
Ces1g T C 8: 93,302,967 T546A probably benign Het
Cfap74 G T 4: 155,426,197 probably null Het
Col5a1 G T 2: 27,952,378 D422Y unknown Het
Cyp2c66 A T 19: 39,141,904 Y61F probably damaging Het
Dnah12 G A 14: 26,778,912 probably null Het
Dnah6 A G 6: 73,181,705 probably null Het
Dopey1 T G 9: 86,504,167 probably null Het
Fam163a A G 1: 156,079,088 F106L probably damaging Het
Gfy T C 7: 45,178,172 T167A probably benign Het
Gm6525 A T 3: 84,175,034 R87S probably benign Het
Gramd1c C A 16: 44,059,221 A19S possibly damaging Het
Herc2 T C 7: 56,131,286 V1233A probably damaging Het
Hibch G A 1: 52,853,715 probably null Het
Ibsp A T 5: 104,302,161 S9C probably benign Het
Il17ra A G 6: 120,475,611 I252V probably benign Het
Ino80 A T 2: 119,374,437 M1536K probably benign Het
Ipo11 A T 13: 106,875,570 L568Q probably damaging Het
Kcnu1 T G 8: 25,919,581 probably null Het
Kdm5b T G 1: 134,624,759 S1158A probably benign Het
Kmt2a T C 9: 44,847,715 T946A probably benign Het
Kmt2e A T 5: 23,492,294 probably benign Het
Krba1 G A 6: 48,412,327 V594M probably damaging Het
Lamb1 T C 12: 31,324,315 L1559P probably damaging Het
Lig1 C T 7: 13,291,249 P227S probably benign Het
Lims2 T A 18: 31,956,964 D255E probably benign Het
Maats1 T C 16: 38,335,597 Y88C probably benign Het
March3 C T 18: 56,776,089 C208Y probably benign Het
Melk G T 4: 44,351,106 R549L probably benign Het
Muc6 AGGCGCAGAAACCCTGGC AGGC 7: 141,634,450 probably null Het
Nae1 T C 8: 104,523,583 Y226C possibly damaging Het
Nap1l1 T C 10: 111,491,103 F175S probably damaging Het
Ndn T C 7: 62,348,961 L185P probably damaging Het
Ndst3 T A 3: 123,671,739 I195F possibly damaging Het
Ndufaf1 A T 2: 119,658,426 S206T probably benign Het
Nek10 C A 14: 14,836,171 H131N probably benign Het
Obsl1 T A 1: 75,489,716 D1456V possibly damaging Het
Olfr1328 C T 4: 118,934,018 V277I probably benign Het
Olfr605 T A 7: 103,443,085 T13S probably benign Het
Olfr714 A G 7: 107,074,241 N138D probably benign Het
Otog C T 7: 46,288,050 L1728F probably damaging Het
Pcx A T 19: 4,602,333 M150L possibly damaging Het
Pole A G 5: 110,297,107 D443G possibly damaging Het
Prr14 G T 7: 127,476,476 R552L probably damaging Het
Rasgrf1 T G 9: 90,017,072 S1156A possibly damaging Het
Rfc4 T A 16: 23,127,609 probably benign Het
Rfx5 G T 3: 94,958,961 A524S unknown Het
Ryr3 G A 2: 112,766,319 P2497S probably damaging Het
Scg3 T C 9: 75,683,710 T6A probably benign Het
Slc26a9 A T 1: 131,762,788 D510V possibly damaging Het
Stpg3 A G 2: 25,214,574 F10L probably damaging Het
Tmc5 T A 7: 118,639,956 H357Q possibly damaging Het
Tmem40 A T 6: 115,730,459 L253H probably damaging Het
Tmie A G 9: 110,867,564 V83A probably damaging Het
Uck2 A T 1: 167,226,515 I218N probably damaging Het
Vtn A G 11: 78,500,800 D310G possibly damaging Het
Wdr49 A T 3: 75,333,273 S430T probably benign Het
Wtip A G 7: 34,132,662 V133A probably benign Het
Zbtb9 T A 17: 26,974,692 V357E probably damaging Het
Zfp953 G A 13: 67,343,642 T82M probably benign Het
Other mutations in Mei1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01612:Mei1 APN 15 82089552 missense probably damaging 0.99
IGL01776:Mei1 APN 15 82095932 critical splice donor site probably null
IGL01864:Mei1 APN 15 82113017 splice site probably benign
IGL02030:Mei1 APN 15 82115743 missense probably benign
IGL02148:Mei1 APN 15 82092711 nonsense probably null
R0135:Mei1 UTSW 15 82071969 nonsense probably null
R0212:Mei1 UTSW 15 82095931 critical splice donor site probably null
R0537:Mei1 UTSW 15 82091361 missense possibly damaging 0.93
R0605:Mei1 UTSW 15 82070150 missense probably benign
R0727:Mei1 UTSW 15 82070149 missense probably benign 0.01
R1118:Mei1 UTSW 15 82115867 splice site probably benign
R1226:Mei1 UTSW 15 82080084 missense possibly damaging 0.92
R1339:Mei1 UTSW 15 82081995 missense possibly damaging 0.66
R1558:Mei1 UTSW 15 82107133 missense probably damaging 1.00
R1769:Mei1 UTSW 15 82112570 intron probably null
R1868:Mei1 UTSW 15 82124953 missense probably damaging 1.00
R1980:Mei1 UTSW 15 82103312 missense probably benign 0.00
R1981:Mei1 UTSW 15 82103312 missense probably benign 0.00
R1982:Mei1 UTSW 15 82103312 missense probably benign 0.00
R2103:Mei1 UTSW 15 82103204 missense possibly damaging 0.91
R2103:Mei1 UTSW 15 82107036 missense probably damaging 0.99
R2207:Mei1 UTSW 15 82103249 missense probably benign 0.08
R2444:Mei1 UTSW 15 82112941 missense probably damaging 1.00
R3009:Mei1 UTSW 15 82112525 missense probably damaging 0.97
R3114:Mei1 UTSW 15 82124959 missense probably benign 0.31
R3546:Mei1 UTSW 15 82098042 missense probably damaging 0.97
R3720:Mei1 UTSW 15 82103204 missense possibly damaging 0.91
R3721:Mei1 UTSW 15 82103204 missense possibly damaging 0.91
R3722:Mei1 UTSW 15 82103204 missense possibly damaging 0.91
R3752:Mei1 UTSW 15 82086182 missense probably damaging 0.97
R3778:Mei1 UTSW 15 82082008 missense probably damaging 1.00
R3848:Mei1 UTSW 15 82113017 splice site probably benign
R3933:Mei1 UTSW 15 82083152 missense possibly damaging 0.75
R4274:Mei1 UTSW 15 82124863 missense possibly damaging 0.66
R4765:Mei1 UTSW 15 82112485 missense possibly damaging 0.96
R5070:Mei1 UTSW 15 82077603 missense possibly damaging 0.66
R5394:Mei1 UTSW 15 82092756 missense possibly damaging 0.83
R6108:Mei1 UTSW 15 82075188 missense possibly damaging 0.66
R6302:Mei1 UTSW 15 82103238 nonsense probably null
R6849:Mei1 UTSW 15 82079945 missense possibly damaging 0.92
R6913:Mei1 UTSW 15 82089609 missense probably benign 0.06
R6919:Mei1 UTSW 15 82081930 missense probably damaging 0.98
R6959:Mei1 UTSW 15 82124875 missense probably benign 0.01
R7007:Mei1 UTSW 15 82093999 missense probably damaging 0.99
R7374:Mei1 UTSW 15 82095908 missense
R7438:Mei1 UTSW 15 82115481 missense
R7757:Mei1 UTSW 15 82082623 intron probably benign
R7857:Mei1 UTSW 15 82092717 missense not run
R7940:Mei1 UTSW 15 82092717 missense not run
RF051:Mei1 UTSW 15 82070010 frame shift probably null
Predicted Primers PCR Primer
(F):5'- TGTGATGGAGCAGTAGAGACTC -3'
(R):5'- CAAGAGTAACATTGCTGGGGTC -3'

Sequencing Primer
(F):5'- TAGACCAGGCTGGCTTTGAACTC -3'
(R):5'- ATTGCTGGGGTCCCGGG -3'
Posted On2019-06-26