Incidental Mutation 'R0592:Olfr1472'
ID56041
Institutional Source Beutler Lab
Gene Symbol Olfr1472
Ensembl Gene ENSMUSG00000095189
Gene Nameolfactory receptor 1472
SynonymsGA_x6K02T2RE5P-3787124-3786180, MOR202-16
MMRRC Submission 038782-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.197) question?
Stock #R0592 (G1)
Quality Score225
Status Validated
Chromosome19
Chromosomal Location13453280-13456086 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 13453705 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Valine at position 271 (I271V)
Ref Sequence ENSEMBL: ENSMUSP00000093915 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000077501] [ENSMUST00000096201]
Predicted Effect probably benign
Transcript: ENSMUST00000077501
AA Change: I271V

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
SMART Domains Protein: ENSMUSP00000076707
Gene: ENSMUSG00000095189
AA Change: I271V

DomainStartEndE-ValueType
Pfam:7tm_4 29 306 2.4e-51 PFAM
Pfam:7TM_GPCR_Srsx 33 303 5.2e-8 PFAM
Pfam:7tm_1 39 288 6.9e-20 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000096201
AA Change: I271V

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
SMART Domains Protein: ENSMUSP00000093915
Gene: ENSMUSG00000095189
AA Change: I271V

DomainStartEndE-ValueType
Pfam:7tm_4 30 306 3.9e-53 PFAM
Pfam:7TM_GPCR_Srsx 34 304 2.6e-6 PFAM
Pfam:7tm_1 40 289 1.2e-16 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000213561
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.9%
  • 10x: 97.5%
  • 20x: 95.0%
Validation Efficiency 100% (35/35)
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 35 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Atg2a GCCTTCCTTCCTTCCTTCCTTCCTTCCTTCCTTCC GCCTTCCTTCCTTCCTTCCTTCCTTCCTTCCTTCCTTCC 19: 6,245,007 probably benign Het
Bbs7 A T 3: 36,610,297 V53D probably benign Het
Bglap T A 3: 88,383,655 I90F probably benign Het
C2cd4b G A 9: 67,760,691 R323H probably damaging Het
Cdh5 T A 8: 104,130,902 probably null Het
Cdh8 T A 8: 99,279,478 D159V probably damaging Het
Dnah7a A G 1: 53,456,612 Y3229H possibly damaging Het
Dzip1 T C 14: 118,902,139 E381G probably damaging Het
Elmod1 A G 9: 53,926,106 probably benign Het
Exosc10 T C 4: 148,581,113 S811P probably benign Het
Fhl3 A G 4: 124,705,677 Y15C probably benign Het
Gstz1 G A 12: 87,163,721 S126N probably benign Het
Hey2 C A 10: 30,833,957 A267S probably benign Het
Iqce A T 5: 140,686,107 probably null Het
Katnal2 A T 18: 77,002,560 probably null Het
Kdm2b G A 5: 122,961,134 probably benign Het
Mov10l1 A G 15: 88,998,766 probably null Het
Numa1 A G 7: 102,013,897 T724A probably benign Het
Oas3 A G 5: 120,771,149 F244S probably damaging Het
Olfr715 G A 7: 107,129,343 L17F probably benign Het
Ppil2 A G 16: 17,107,219 S30P probably benign Het
Rab37 T G 11: 115,160,523 probably benign Het
Riox2 T C 16: 59,489,579 probably benign Het
Ryr3 A G 2: 112,678,481 S3358P probably damaging Het
Sash1 T A 10: 8,729,782 H948L probably benign Het
Serpinb6e T A 13: 33,841,074 N78I probably damaging Het
Slc25a47 G A 12: 108,854,258 V63M probably damaging Het
Slc9b1 A T 3: 135,394,074 probably benign Het
Strip2 T A 6: 29,931,210 S387T probably benign Het
Tcaf3 T C 6: 42,596,843 N145S probably benign Het
Tex10 C T 4: 48,456,800 R637Q probably benign Het
Trmu T C 15: 85,896,826 probably benign Het
Vezf1 A T 11: 88,068,435 probably benign Het
Vmn2r116 C T 17: 23,386,915 T267I probably damaging Het
Whrn C A 4: 63,415,567 A450S probably damaging Het
Other mutations in Olfr1472
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00229:Olfr1472 APN 19 13453840 missense possibly damaging 0.46
IGL01755:Olfr1472 APN 19 13453815 missense probably damaging 1.00
IGL01885:Olfr1472 APN 19 13454085 missense probably benign 0.00
IGL02366:Olfr1472 APN 19 13454127 missense probably damaging 1.00
IGL03074:Olfr1472 APN 19 13454053 missense probably damaging 0.98
R1085:Olfr1472 UTSW 19 13454230 missense possibly damaging 0.75
R4207:Olfr1472 UTSW 19 13454471 missense probably benign 0.15
R4856:Olfr1472 UTSW 19 13454521 unclassified probably null
R4886:Olfr1472 UTSW 19 13454521 unclassified probably null
R5061:Olfr1472 UTSW 19 13453985 nonsense probably null
R5167:Olfr1472 UTSW 19 13454377 missense probably damaging 1.00
R5509:Olfr1472 UTSW 19 13453968 missense probably damaging 1.00
R5586:Olfr1472 UTSW 19 13454382 missense probably benign 0.02
R5987:Olfr1472 UTSW 19 13453960 missense possibly damaging 0.57
R6631:Olfr1472 UTSW 19 13453821 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- TCAATGCATGAGTACACAGTTCTCCTTC -3'
(R):5'- TGCAGCAGTGTGCAATCCCC -3'

Sequencing Primer
(F):5'- GAGTACACAGTTCTCCTTCATAAAG -3'
(R):5'- CATGTGTGGAATCTTGCAATCC -3'
Posted On2013-07-11