Incidental Mutation 'R7204:Ttc17'
ID560418
Institutional Source Beutler Lab
Gene Symbol Ttc17
Ensembl Gene ENSMUSG00000027194
Gene Nametetratricopeptide repeat domain 17
SynonymsD2Bwg1005e, 9130020K17Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.567) question?
Stock #R7204 (G1)
Quality Score225.009
Status Validated
Chromosome2
Chromosomal Location94300767-94406689 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 94362428 bp
ZygosityHeterozygous
Amino Acid Change Valine to Aspartic acid at position 86 (V86D)
Ref Sequence ENSEMBL: ENSMUSP00000061360 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000055081] [ENSMUST00000094801] [ENSMUST00000111237] [ENSMUST00000111238]
Predicted Effect possibly damaging
Transcript: ENSMUST00000055081
AA Change: V86D

PolyPhen 2 Score 0.952 (Sensitivity: 0.79; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000061360
Gene: ENSMUSG00000027194
AA Change: V86D

DomainStartEndE-ValueType
TPR 46 79 1.33e1 SMART
Blast:TPR 82 115 3e-10 BLAST
TPR 116 149 4.91e-4 SMART
low complexity region 326 344 N/A INTRINSIC
TPR 499 532 2.43e1 SMART
TPR 535 568 6.75e1 SMART
TPR 569 602 6.84e-3 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000094801
AA Change: V659D

PolyPhen 2 Score 0.994 (Sensitivity: 0.69; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000092395
Gene: ENSMUSG00000027194
AA Change: V659D

DomainStartEndE-ValueType
low complexity region 22 38 N/A INTRINSIC
internal_repeat_1 113 271 7.26e-16 PROSPERO
low complexity region 275 293 N/A INTRINSIC
TPR 295 328 1.39e-3 SMART
coiled coil region 340 382 N/A INTRINSIC
TPR 619 652 1.33e1 SMART
Blast:TPR 655 688 3e-10 BLAST
TPR 689 722 4.91e-4 SMART
low complexity region 899 917 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000111237
AA Change: V659D

PolyPhen 2 Score 0.905 (Sensitivity: 0.82; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000106868
Gene: ENSMUSG00000027194
AA Change: V659D

DomainStartEndE-ValueType
low complexity region 22 38 N/A INTRINSIC
Blast:TPR 225 258 8e-11 BLAST
low complexity region 275 293 N/A INTRINSIC
TPR 295 328 1.39e-3 SMART
TPR 619 652 1.33e1 SMART
Blast:TPR 655 688 4e-10 BLAST
TPR 689 722 4.91e-4 SMART
low complexity region 842 860 N/A INTRINSIC
TPR 1015 1048 2.43e1 SMART
TPR 1051 1084 6.75e1 SMART
TPR 1085 1118 6.84e-3 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000111238
AA Change: V659D

PolyPhen 2 Score 0.952 (Sensitivity: 0.79; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000106869
Gene: ENSMUSG00000027194
AA Change: V659D

DomainStartEndE-ValueType
low complexity region 22 38 N/A INTRINSIC
internal_repeat_2 113 271 8.31e-15 PROSPERO
low complexity region 275 293 N/A INTRINSIC
TPR 295 328 1.39e-3 SMART
coiled coil region 340 382 N/A INTRINSIC
TPR 619 652 1.33e1 SMART
Blast:TPR 655 688 4e-10 BLAST
TPR 689 722 4.91e-4 SMART
low complexity region 899 917 N/A INTRINSIC
TPR 1072 1105 2.43e1 SMART
TPR 1108 1141 6.75e1 SMART
TPR 1142 1175 6.84e-3 SMART
Meta Mutation Damage Score 0.7136 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.6%
Validation Efficiency 99% (75/76)
Allele List at MGI
Other mutations in this stock
Total: 75 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700067K01Rik T C 8: 84,004,007 S227P probably damaging Het
4930444G20Rik A G 10: 22,067,886 L65P probably damaging Het
9130019O22Rik A T 7: 127,384,346 I528K possibly damaging Het
Acot6 A G 12: 84,106,527 H181R probably benign Het
Adam15 A T 3: 89,346,937 H184Q probably benign Het
Agl A G 3: 116,793,820 F29L probably benign Het
Ak7 A G 12: 105,742,243 Y319C probably benign Het
Ano8 C A 8: 71,479,025 V813L probably benign Het
Apbb2 T G 5: 66,451,603 K234Q probably damaging Het
Arfgef3 A T 10: 18,646,462 D605E probably damaging Het
Bfsp2 C A 9: 103,432,666 R340L probably damaging Het
Birc6 C A 17: 74,640,108 P2956T probably damaging Het
C1rb T C 6: 124,577,427 I389T probably benign Het
Ccdc146 A G 5: 21,308,626 F498S probably benign Het
Cdc14b A C 13: 64,210,198 V361G possibly damaging Het
Cdc25b A T 2: 131,191,632 I164F probably damaging Het
Col18a1 A G 10: 77,085,276 S297P unknown Het
Col3a1 A T 1: 45,322,418 I117F unknown Het
Cox4i2 AG A 2: 152,760,698 probably null Het
Crybg3 C A 16: 59,558,890 G667V probably benign Het
Ctc1 A G 11: 69,029,741 D623G probably damaging Het
Dennd1a A T 2: 38,039,203 H152Q probably damaging Het
Dgke G A 11: 89,041,480 P495S probably damaging Het
Dll3 A T 7: 28,298,905 C212S possibly damaging Het
Dll4 A T 2: 119,328,573 S235C probably damaging Het
Dnah12 G A 14: 26,778,912 probably null Het
Dnah12 A T 14: 26,781,485 T1599S probably damaging Het
Elavl1 G A 8: 4,311,712 T20M probably damaging Het
Epha3 T C 16: 63,652,332 T397A probably benign Het
Fanca A T 8: 123,286,477 I859N probably damaging Het
Fzd1 A T 5: 4,755,980 V534D probably damaging Het
Glmp A G 3: 88,326,610 Y258C probably damaging Het
Gm9195 G A 14: 72,474,186 P329S probably damaging Het
Gm9573 AGCTGGATGCAGTGGTGGTCAGGGTGGGTGTAGAGCCTGAGCCAGTGCTGGATACAGTGGTGGTC AGCTGGATACAGTGGTGGTC 17: 35,621,213 probably benign Het
Gpt A G 15: 76,698,999 R379G probably benign Het
Gsdmc2 T C 15: 63,825,054 T423A probably damaging Het
Hemgn T C 4: 46,397,054 K61E possibly damaging Het
Ikzf4 A T 10: 128,643,890 S56T possibly damaging Het
Jak1 T C 4: 101,175,135 T425A probably benign Het
Jsrp1 T C 10: 80,810,485 T80A probably benign Het
Klra9 T A 6: 130,188,680 D124V possibly damaging Het
Lama5 A T 2: 180,202,177 V397D probably damaging Het
Lrp2 A G 2: 69,472,533 S2951P probably benign Het
Map7d1 A G 4: 126,256,015 probably null Het
Mcm6 A T 1: 128,338,127 C636S probably damaging Het
Mia T C 7: 27,180,933 E39G possibly damaging Het
Mpeg1 T A 19: 12,462,894 I572N probably damaging Het
Muc6 AGGCGCAGAAACCCTGGC AGGC 7: 141,634,450 probably null Het
Mup5 A G 4: 61,833,755 Y86H probably damaging Het
Nckap5 A T 1: 126,026,367 V816D probably benign Het
Nfib T C 4: 82,296,815 probably null Het
Nlrc5 T A 8: 94,491,525 V1056D possibly damaging Het
Nynrin G C 14: 55,872,733 E1766Q probably damaging Het
Olfr39 A T 9: 20,285,804 Y43F probably benign Het
Oxct1 T A 15: 4,094,042 L328Q probably damaging Het
Pax5 T A 4: 44,679,485 I187F possibly damaging Het
Pcdhb4 A T 18: 37,309,239 D534V probably damaging Het
Pebp4 C T 14: 69,847,597 P35S probably benign Het
Pkhd1l1 T A 15: 44,523,553 V1274E possibly damaging Het
Plcz1 A T 6: 140,010,424 V373D probably benign Het
Plxnb1 C T 9: 109,100,175 T33I probably damaging Het
Prag1 T C 8: 36,146,761 C1156R probably benign Het
Ptprc T A 1: 138,117,862 I87F probably benign Het
Rbp4 G A 19: 38,124,103 T138I possibly damaging Het
Slc12a1 A T 2: 125,200,622 N733Y possibly damaging Het
Slc27a3 A G 3: 90,389,726 V22A probably benign Het
Tcaf1 T C 6: 42,675,039 probably null Het
Tnc T C 4: 63,971,155 probably null Het
Tspan31 A T 10: 127,068,118 *211R probably null Het
Ubr1 T A 2: 120,904,077 N1114I possibly damaging Het
Ulk2 C T 11: 61,783,631 G850R probably benign Het
Vmn1r13 T A 6: 57,210,156 I100N probably benign Het
Zan T C 5: 137,427,978 D2512G unknown Het
Zc3h14 A T 12: 98,771,356 N34I probably damaging Het
Zcwpw1 T G 5: 137,812,084 L374R probably damaging Het
Other mutations in Ttc17
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00163:Ttc17 APN 2 94323083 splice site probably benign
IGL00870:Ttc17 APN 2 94371733 splice site probably null
IGL01120:Ttc17 APN 2 94371796 missense probably damaging 1.00
IGL01845:Ttc17 APN 2 94332832 nonsense probably null
IGL01895:Ttc17 APN 2 94375146 missense possibly damaging 0.80
IGL02064:Ttc17 APN 2 94330667 missense probably damaging 1.00
IGL02296:Ttc17 APN 2 94377710 missense probably damaging 1.00
IGL02309:Ttc17 APN 2 94342661 missense probably benign
IGL02456:Ttc17 APN 2 94362785 splice site probably benign
IGL02475:Ttc17 APN 2 94364376 missense probably damaging 1.00
IGL03341:Ttc17 APN 2 94375221 missense probably damaging 1.00
IGL03371:Ttc17 APN 2 94386105 missense probably damaging 1.00
R0389:Ttc17 UTSW 2 94378094 missense probably benign 0.03
R0443:Ttc17 UTSW 2 94378094 missense probably benign 0.03
R0511:Ttc17 UTSW 2 94323120 missense possibly damaging 0.87
R0763:Ttc17 UTSW 2 94332803 missense probably benign 0.08
R1980:Ttc17 UTSW 2 94326704 missense possibly damaging 0.82
R1981:Ttc17 UTSW 2 94326704 missense possibly damaging 0.82
R1987:Ttc17 UTSW 2 94364345 missense probably benign
R2064:Ttc17 UTSW 2 94366547 missense probably damaging 1.00
R2147:Ttc17 UTSW 2 94301794 missense possibly damaging 0.87
R2155:Ttc17 UTSW 2 94366642 missense possibly damaging 0.88
R2844:Ttc17 UTSW 2 94376074 nonsense probably null
R3719:Ttc17 UTSW 2 94364327 missense probably benign 0.27
R3852:Ttc17 UTSW 2 94369413 missense possibly damaging 0.86
R3947:Ttc17 UTSW 2 94376146 splice site probably benign
R4411:Ttc17 UTSW 2 94342753 missense probably damaging 0.97
R4461:Ttc17 UTSW 2 94366571 missense probably benign 0.02
R4660:Ttc17 UTSW 2 94364429 missense possibly damaging 0.51
R4762:Ttc17 UTSW 2 94371768 missense probably damaging 1.00
R4818:Ttc17 UTSW 2 94332891 missense possibly damaging 0.91
R4819:Ttc17 UTSW 2 94364610 missense probably damaging 1.00
R4864:Ttc17 UTSW 2 94366635 missense probably benign 0.01
R4870:Ttc17 UTSW 2 94366609 missense probably damaging 1.00
R5203:Ttc17 UTSW 2 94378716 missense probably damaging 1.00
R5288:Ttc17 UTSW 2 94303640 missense probably damaging 1.00
R5385:Ttc17 UTSW 2 94303640 missense probably damaging 1.00
R5386:Ttc17 UTSW 2 94303640 missense probably damaging 1.00
R5453:Ttc17 UTSW 2 94303560 missense probably damaging 1.00
R5583:Ttc17 UTSW 2 94377682 missense probably damaging 1.00
R5683:Ttc17 UTSW 2 94362521 missense probably damaging 1.00
R5921:Ttc17 UTSW 2 94378848 missense probably damaging 1.00
R6272:Ttc17 UTSW 2 94358755 missense probably damaging 1.00
R6444:Ttc17 UTSW 2 94303546 missense possibly damaging 0.57
R6748:Ttc17 UTSW 2 94386102 missense probably benign 0.02
R7300:Ttc17 UTSW 2 94375134 missense probably damaging 1.00
R7446:Ttc17 UTSW 2 94375150 missense probably damaging 0.97
R7680:Ttc17 UTSW 2 94366544 missense probably benign 0.06
X0013:Ttc17 UTSW 2 94330670 missense probably damaging 1.00
X0018:Ttc17 UTSW 2 94378716 missense probably damaging 1.00
X0025:Ttc17 UTSW 2 94324516 missense possibly damaging 0.86
Predicted Primers PCR Primer
(F):5'- TCCTAGACAGACTCAAAGCTTACTG -3'
(R):5'- GGGACCTCTAAAACTTAAATCCTTC -3'

Sequencing Primer
(F):5'- GACTCAAAGCTTACTGTACAGTCAAG -3'
(R):5'- TAGGACCAGCACTCTACTTTATAC -3'
Posted On2019-06-26