Incidental Mutation 'R7204:Dll4'
ID560419
Institutional Source Beutler Lab
Gene Symbol Dll4
Ensembl Gene ENSMUSG00000027314
Gene Namedelta like canonical Notch ligand 4
SynonymsDelta4
MMRRC Submission
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R7204 (G1)
Quality Score225.009
Status Validated
Chromosome2
Chromosomal Location119325784-119335962 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 119328573 bp
ZygosityHeterozygous
Amino Acid Change Serine to Cysteine at position 235 (S235C)
Ref Sequence ENSEMBL: ENSMUSP00000099575 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000102517]
Predicted Effect probably damaging
Transcript: ENSMUST00000102517
AA Change: S235C

PolyPhen 2 Score 0.977 (Sensitivity: 0.76; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000099575
Gene: ENSMUSG00000027314
AA Change: S235C

DomainStartEndE-ValueType
Pfam:MNNL 27 92 7.3e-21 PFAM
low complexity region 139 150 N/A INTRINSIC
DSL 156 218 1.98e-23 SMART
EGF 222 252 5.62e0 SMART
EGF 253 283 5.79e-2 SMART
EGF_CA 285 323 1.38e-8 SMART
EGF_CA 329 361 5.36e-6 SMART
EGF 366 401 4.35e-6 SMART
EGF 406 439 1.44e-6 SMART
EGF_CA 441 477 2.33e-6 SMART
EGF 484 519 9.33e-6 SMART
transmembrane domain 530 552 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.6%
Validation Efficiency 99% (75/76)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is a homolog of the Drosophila delta gene. The delta gene family encodes Notch ligands that are characterized by a DSL domain, EGF repeats, and a transmembrane domain. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous null mice display embryonic lethality, absent vascular remodeling, small hearts, and embryonic growth retardation. Heterozygous null mice display background dependent partial or complete embryonic lethality, impaired vascular remodeling, and embryonic growth retardation. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 75 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700067K01Rik T C 8: 84,004,007 S227P probably damaging Het
4930444G20Rik A G 10: 22,067,886 L65P probably damaging Het
9130019O22Rik A T 7: 127,384,346 I528K possibly damaging Het
Acot6 A G 12: 84,106,527 H181R probably benign Het
Adam15 A T 3: 89,346,937 H184Q probably benign Het
Agl A G 3: 116,793,820 F29L probably benign Het
Ak7 A G 12: 105,742,243 Y319C probably benign Het
Ano8 C A 8: 71,479,025 V813L probably benign Het
Apbb2 T G 5: 66,451,603 K234Q probably damaging Het
Arfgef3 A T 10: 18,646,462 D605E probably damaging Het
Bfsp2 C A 9: 103,432,666 R340L probably damaging Het
Birc6 C A 17: 74,640,108 P2956T probably damaging Het
C1rb T C 6: 124,577,427 I389T probably benign Het
Ccdc146 A G 5: 21,308,626 F498S probably benign Het
Cdc14b A C 13: 64,210,198 V361G possibly damaging Het
Cdc25b A T 2: 131,191,632 I164F probably damaging Het
Col18a1 A G 10: 77,085,276 S297P unknown Het
Col3a1 A T 1: 45,322,418 I117F unknown Het
Cox4i2 AG A 2: 152,760,698 probably null Het
Crybg3 C A 16: 59,558,890 G667V probably benign Het
Ctc1 A G 11: 69,029,741 D623G probably damaging Het
Dennd1a A T 2: 38,039,203 H152Q probably damaging Het
Dgke G A 11: 89,041,480 P495S probably damaging Het
Dll3 A T 7: 28,298,905 C212S possibly damaging Het
Dnah12 G A 14: 26,778,912 probably null Het
Dnah12 A T 14: 26,781,485 T1599S probably damaging Het
Elavl1 G A 8: 4,311,712 T20M probably damaging Het
Epha3 T C 16: 63,652,332 T397A probably benign Het
Fanca A T 8: 123,286,477 I859N probably damaging Het
Fzd1 A T 5: 4,755,980 V534D probably damaging Het
Glmp A G 3: 88,326,610 Y258C probably damaging Het
Gm9195 G A 14: 72,474,186 P329S probably damaging Het
Gm9573 AGCTGGATGCAGTGGTGGTCAGGGTGGGTGTAGAGCCTGAGCCAGTGCTGGATACAGTGGTGGTC AGCTGGATACAGTGGTGGTC 17: 35,621,213 probably benign Het
Gpt A G 15: 76,698,999 R379G probably benign Het
Gsdmc2 T C 15: 63,825,054 T423A probably damaging Het
Hemgn T C 4: 46,397,054 K61E possibly damaging Het
Ikzf4 A T 10: 128,643,890 S56T possibly damaging Het
Jak1 T C 4: 101,175,135 T425A probably benign Het
Jsrp1 T C 10: 80,810,485 T80A probably benign Het
Klra9 T A 6: 130,188,680 D124V possibly damaging Het
Lama5 A T 2: 180,202,177 V397D probably damaging Het
Lrp2 A G 2: 69,472,533 S2951P probably benign Het
Map7d1 A G 4: 126,256,015 probably null Het
Mcm6 A T 1: 128,338,127 C636S probably damaging Het
Mia T C 7: 27,180,933 E39G possibly damaging Het
Mpeg1 T A 19: 12,462,894 I572N probably damaging Het
Muc6 AGGCGCAGAAACCCTGGC AGGC 7: 141,634,450 probably null Het
Mup5 A G 4: 61,833,755 Y86H probably damaging Het
Nckap5 A T 1: 126,026,367 V816D probably benign Het
Nfib T C 4: 82,296,815 probably null Het
Nlrc5 T A 8: 94,491,525 V1056D possibly damaging Het
Nynrin G C 14: 55,872,733 E1766Q probably damaging Het
Olfr39 A T 9: 20,285,804 Y43F probably benign Het
Oxct1 T A 15: 4,094,042 L328Q probably damaging Het
Pax5 T A 4: 44,679,485 I187F possibly damaging Het
Pcdhb4 A T 18: 37,309,239 D534V probably damaging Het
Pebp4 C T 14: 69,847,597 P35S probably benign Het
Pkhd1l1 T A 15: 44,523,553 V1274E possibly damaging Het
Plcz1 A T 6: 140,010,424 V373D probably benign Het
Plxnb1 C T 9: 109,100,175 T33I probably damaging Het
Prag1 T C 8: 36,146,761 C1156R probably benign Het
Ptprc T A 1: 138,117,862 I87F probably benign Het
Rbp4 G A 19: 38,124,103 T138I possibly damaging Het
Slc12a1 A T 2: 125,200,622 N733Y possibly damaging Het
Slc27a3 A G 3: 90,389,726 V22A probably benign Het
Tcaf1 T C 6: 42,675,039 probably null Het
Tnc T C 4: 63,971,155 probably null Het
Tspan31 A T 10: 127,068,118 *211R probably null Het
Ttc17 A T 2: 94,362,428 V86D possibly damaging Het
Ubr1 T A 2: 120,904,077 N1114I possibly damaging Het
Ulk2 C T 11: 61,783,631 G850R probably benign Het
Vmn1r13 T A 6: 57,210,156 I100N probably benign Het
Zan T C 5: 137,427,978 D2512G unknown Het
Zc3h14 A T 12: 98,771,356 N34I probably damaging Het
Zcwpw1 T G 5: 137,812,084 L374R probably damaging Het
Other mutations in Dll4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01149:Dll4 APN 2 119331109 missense probably damaging 1.00
IGL01149:Dll4 APN 2 119332745 missense probably damaging 1.00
IGL02511:Dll4 APN 2 119326466 missense probably damaging 0.99
PIT4519001:Dll4 UTSW 2 119332416 missense probably benign 0.01
R0316:Dll4 UTSW 2 119331153 missense probably damaging 1.00
R0725:Dll4 UTSW 2 119332689 missense probably damaging 1.00
R0840:Dll4 UTSW 2 119326485 missense probably benign 0.01
R1014:Dll4 UTSW 2 119331157 missense probably damaging 1.00
R1650:Dll4 UTSW 2 119331130 missense probably damaging 1.00
R3813:Dll4 UTSW 2 119331029 missense possibly damaging 0.65
R3974:Dll4 UTSW 2 119334092 missense probably damaging 0.98
R5320:Dll4 UTSW 2 119326487 missense probably damaging 0.97
R6166:Dll4 UTSW 2 119334626 critical splice acceptor site probably null
R6305:Dll4 UTSW 2 119330657 missense probably benign 0.01
R6455:Dll4 UTSW 2 119333795 splice site probably null
R6617:Dll4 UTSW 2 119327931 missense probably benign
R6843:Dll4 UTSW 2 119325994 start gained probably benign
R7251:Dll4 UTSW 2 119332292 missense probably damaging 1.00
Z1176:Dll4 UTSW 2 119326052 start gained probably benign
Predicted Primers PCR Primer
(F):5'- TTAAGCCTACAGGGTCCTTATTC -3'
(R):5'- ATGACGACAGCCATTGTGGG -3'

Sequencing Primer
(F):5'- TCATCCCATGCAGTGTGATG -3'
(R):5'- GGGATACATTCATTGCACAGGC -3'
Posted On2019-06-26