Incidental Mutation 'R7204:Map7d1'
ID560433
Institutional Source Beutler Lab
Gene Symbol Map7d1
Ensembl Gene ENSMUSG00000028849
Gene NameMAP7 domain containing 1
SynonymsMtap7d1, Parcc1, Rprc1
MMRRC Submission
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.709) question?
Stock #R7204 (G1)
Quality Score148.008
Status Validated
Chromosome4
Chromosomal Location126232167-126256343 bp(-) (GRCm38)
Type of Mutationcritical splice donor site (2 bp from exon)
DNA Base Change (assembly) A to G at 126256015 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000054338 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000061143] [ENSMUST00000106132] [ENSMUST00000122129]
Predicted Effect probably null
Transcript: ENSMUST00000061143
SMART Domains Protein: ENSMUSP00000054338
Gene: ENSMUSG00000028849

DomainStartEndE-ValueType
low complexity region 25 47 N/A INTRINSIC
low complexity region 110 123 N/A INTRINSIC
coiled coil region 163 224 N/A INTRINSIC
low complexity region 323 343 N/A INTRINSIC
coiled coil region 414 444 N/A INTRINSIC
low complexity region 460 471 N/A INTRINSIC
low complexity region 480 497 N/A INTRINSIC
low complexity region 533 558 N/A INTRINSIC
Pfam:MAP7 587 735 7.1e-41 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000106132
SMART Domains Protein: ENSMUSP00000101738
Gene: ENSMUSG00000028849

DomainStartEndE-ValueType
low complexity region 25 47 N/A INTRINSIC
low complexity region 110 123 N/A INTRINSIC
coiled coil region 163 224 N/A INTRINSIC
coiled coil region 342 372 N/A INTRINSIC
low complexity region 388 399 N/A INTRINSIC
low complexity region 408 425 N/A INTRINSIC
low complexity region 461 486 N/A INTRINSIC
Pfam:MAP7 510 668 1.4e-61 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000122129
SMART Domains Protein: ENSMUSP00000113250
Gene: ENSMUSG00000028849

DomainStartEndE-ValueType
low complexity region 25 47 N/A INTRINSIC
low complexity region 110 123 N/A INTRINSIC
coiled coil region 163 224 N/A INTRINSIC
coiled coil region 382 412 N/A INTRINSIC
low complexity region 428 439 N/A INTRINSIC
low complexity region 448 465 N/A INTRINSIC
low complexity region 501 526 N/A INTRINSIC
Pfam:MAP7 550 708 1.5e-61 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.6%
Validation Efficiency 99% (75/76)
Allele List at MGI
Other mutations in this stock
Total: 75 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700067K01Rik T C 8: 84,004,007 S227P probably damaging Het
4930444G20Rik A G 10: 22,067,886 L65P probably damaging Het
9130019O22Rik A T 7: 127,384,346 I528K possibly damaging Het
Acot6 A G 12: 84,106,527 H181R probably benign Het
Adam15 A T 3: 89,346,937 H184Q probably benign Het
Agl A G 3: 116,793,820 F29L probably benign Het
Ak7 A G 12: 105,742,243 Y319C probably benign Het
Ano8 C A 8: 71,479,025 V813L probably benign Het
Apbb2 T G 5: 66,451,603 K234Q probably damaging Het
Arfgef3 A T 10: 18,646,462 D605E probably damaging Het
Bfsp2 C A 9: 103,432,666 R340L probably damaging Het
Birc6 C A 17: 74,640,108 P2956T probably damaging Het
C1rb T C 6: 124,577,427 I389T probably benign Het
Ccdc146 A G 5: 21,308,626 F498S probably benign Het
Cdc14b A C 13: 64,210,198 V361G possibly damaging Het
Cdc25b A T 2: 131,191,632 I164F probably damaging Het
Col18a1 A G 10: 77,085,276 S297P unknown Het
Col3a1 A T 1: 45,322,418 I117F unknown Het
Cox4i2 AG A 2: 152,760,698 probably null Het
Crybg3 C A 16: 59,558,890 G667V probably benign Het
Ctc1 A G 11: 69,029,741 D623G probably damaging Het
Dennd1a A T 2: 38,039,203 H152Q probably damaging Het
Dgke G A 11: 89,041,480 P495S probably damaging Het
Dll3 A T 7: 28,298,905 C212S possibly damaging Het
Dll4 A T 2: 119,328,573 S235C probably damaging Het
Dnah12 G A 14: 26,778,912 probably null Het
Dnah12 A T 14: 26,781,485 T1599S probably damaging Het
Elavl1 G A 8: 4,311,712 T20M probably damaging Het
Epha3 T C 16: 63,652,332 T397A probably benign Het
Fanca A T 8: 123,286,477 I859N probably damaging Het
Fzd1 A T 5: 4,755,980 V534D probably damaging Het
Glmp A G 3: 88,326,610 Y258C probably damaging Het
Gm9195 G A 14: 72,474,186 P329S probably damaging Het
Gm9573 AGCTGGATGCAGTGGTGGTCAGGGTGGGTGTAGAGCCTGAGCCAGTGCTGGATACAGTGGTGGTC AGCTGGATACAGTGGTGGTC 17: 35,621,213 probably benign Het
Gpt A G 15: 76,698,999 R379G probably benign Het
Gsdmc2 T C 15: 63,825,054 T423A probably damaging Het
Hemgn T C 4: 46,397,054 K61E possibly damaging Het
Ikzf4 A T 10: 128,643,890 S56T possibly damaging Het
Jak1 T C 4: 101,175,135 T425A probably benign Het
Jsrp1 T C 10: 80,810,485 T80A probably benign Het
Klra9 T A 6: 130,188,680 D124V possibly damaging Het
Lama5 A T 2: 180,202,177 V397D probably damaging Het
Lrp2 A G 2: 69,472,533 S2951P probably benign Het
Mcm6 A T 1: 128,338,127 C636S probably damaging Het
Mia T C 7: 27,180,933 E39G possibly damaging Het
Mpeg1 T A 19: 12,462,894 I572N probably damaging Het
Muc6 AGGCGCAGAAACCCTGGC AGGC 7: 141,634,450 probably null Het
Mup5 A G 4: 61,833,755 Y86H probably damaging Het
Nckap5 A T 1: 126,026,367 V816D probably benign Het
Nfib T C 4: 82,296,815 probably null Het
Nlrc5 T A 8: 94,491,525 V1056D possibly damaging Het
Nynrin G C 14: 55,872,733 E1766Q probably damaging Het
Olfr39 A T 9: 20,285,804 Y43F probably benign Het
Oxct1 T A 15: 4,094,042 L328Q probably damaging Het
Pax5 T A 4: 44,679,485 I187F possibly damaging Het
Pcdhb4 A T 18: 37,309,239 D534V probably damaging Het
Pebp4 C T 14: 69,847,597 P35S probably benign Het
Pkhd1l1 T A 15: 44,523,553 V1274E possibly damaging Het
Plcz1 A T 6: 140,010,424 V373D probably benign Het
Plxnb1 C T 9: 109,100,175 T33I probably damaging Het
Prag1 T C 8: 36,146,761 C1156R probably benign Het
Ptprc T A 1: 138,117,862 I87F probably benign Het
Rbp4 G A 19: 38,124,103 T138I possibly damaging Het
Slc12a1 A T 2: 125,200,622 N733Y possibly damaging Het
Slc27a3 A G 3: 90,389,726 V22A probably benign Het
Tcaf1 T C 6: 42,675,039 probably null Het
Tnc T C 4: 63,971,155 probably null Het
Tspan31 A T 10: 127,068,118 *211R probably null Het
Ttc17 A T 2: 94,362,428 V86D possibly damaging Het
Ubr1 T A 2: 120,904,077 N1114I possibly damaging Het
Ulk2 C T 11: 61,783,631 G850R probably benign Het
Vmn1r13 T A 6: 57,210,156 I100N probably benign Het
Zan T C 5: 137,427,978 D2512G unknown Het
Zc3h14 A T 12: 98,771,356 N34I probably damaging Het
Zcwpw1 T G 5: 137,812,084 L374R probably damaging Het
Other mutations in Map7d1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00924:Map7d1 APN 4 126238605 missense probably damaging 1.00
IGL02298:Map7d1 APN 4 126233921 missense unknown
R0136:Map7d1 UTSW 4 126236631 critical splice donor site probably null
R0362:Map7d1 UTSW 4 126234994 missense probably damaging 1.00
R1138:Map7d1 UTSW 4 126242119 missense possibly damaging 0.82
R1499:Map7d1 UTSW 4 126234765 critical splice donor site probably null
R1692:Map7d1 UTSW 4 126242308 missense probably damaging 0.99
R3805:Map7d1 UTSW 4 126237291 splice site probably null
R4369:Map7d1 UTSW 4 126235073 missense probably damaging 0.99
R4814:Map7d1 UTSW 4 126234321 critical splice donor site probably null
R4893:Map7d1 UTSW 4 126233222 missense unknown
R4898:Map7d1 UTSW 4 126233225 missense unknown
R4911:Map7d1 UTSW 4 126236691 missense probably damaging 1.00
R4949:Map7d1 UTSW 4 126235053 nonsense probably null
R5189:Map7d1 UTSW 4 126242304 unclassified probably null
R6198:Map7d1 UTSW 4 126241843 missense probably damaging 1.00
R6336:Map7d1 UTSW 4 126236682 missense probably damaging 1.00
R6558:Map7d1 UTSW 4 126232909 missense unknown
R6781:Map7d1 UTSW 4 126240751 frame shift probably null
R7177:Map7d1 UTSW 4 126236985 missense probably damaging 1.00
R7269:Map7d1 UTSW 4 126232873 missense unknown
R7486:Map7d1 UTSW 4 126234386 missense unknown
R7560:Map7d1 UTSW 4 126236636 missense probably damaging 1.00
Z1177:Map7d1 UTSW 4 126234377 missense unknown
Predicted Primers PCR Primer
(F):5'- AGCTGTCAGAAGATGCGTC -3'
(R):5'- GGCTACTCAGAGCTTCGTTAG -3'

Sequencing Primer
(F):5'- TCAGAAGATGCGTCCGTGG -3'
(R):5'- GCTTCGTTAGCCACCGG -3'
Posted On2019-06-26