Incidental Mutation 'R7204:Nlrc5'
ID560451
Institutional Source Beutler Lab
Gene Symbol Nlrc5
Ensembl Gene ENSMUSG00000074151
Gene NameNLR family, CARD domain containing 5
SynonymsAI451557
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R7204 (G1)
Quality Score225.009
Status Validated
Chromosome8
Chromosomal Location94434356-94527272 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 94491525 bp
ZygosityHeterozygous
Amino Acid Change Valine to Aspartic acid at position 1056 (V1056D)
Ref Sequence ENSEMBL: ENSMUSP00000138322 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000053085] [ENSMUST00000182409] [ENSMUST00000211816]
PDB Structure
The solution NMR structure of the NLRC5 caspase recruitment domain (CARD) [SOLUTION NMR]
Predicted Effect possibly damaging
Transcript: ENSMUST00000053085
AA Change: V1056D

PolyPhen 2 Score 0.831 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000138322
Gene: ENSMUSG00000074151
AA Change: V1056D

DomainStartEndE-ValueType
low complexity region 136 151 N/A INTRINSIC
Pfam:NACHT 223 386 1.8e-32 PFAM
LRR 716 743 6.89e1 SMART
LRR 744 771 9.86e1 SMART
LRR 772 796 1.22e2 SMART
LRR 844 870 2.16e2 SMART
LRR 871 898 1.76e-1 SMART
LRR 1006 1033 1.9e0 SMART
LRR 1034 1061 4.51e1 SMART
low complexity region 1141 1169 N/A INTRINSIC
LRR 1240 1267 2.67e1 SMART
LRR 1273 1295 1.22e1 SMART
low complexity region 1341 1351 N/A INTRINSIC
LRR 1519 1546 5.48e1 SMART
LRR 1547 1574 3.36e1 SMART
LRR 1575 1602 1.69e1 SMART
LRR 1603 1630 8.99e-1 SMART
LRR 1631 1654 5.26e0 SMART
LRR 1659 1686 2.81e0 SMART
LRR 1687 1714 1.6e-4 SMART
LRR 1715 1742 1.06e0 SMART
LRR 1743 1768 8e0 SMART
LRR 1793 1820 2.06e1 SMART
LRR 1821 1848 5.42e-2 SMART
LRR 1849 1876 3.54e0 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000182409
AA Change: V1056D

PolyPhen 2 Score 0.487 (Sensitivity: 0.88; Specificity: 0.90)
Predicted Effect probably benign
Transcript: ENSMUST00000183132
Predicted Effect possibly damaging
Transcript: ENSMUST00000211816
AA Change: V1056D

PolyPhen 2 Score 0.831 (Sensitivity: 0.84; Specificity: 0.93)
Meta Mutation Damage Score 0.134 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.6%
Validation Efficiency 99% (75/76)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the caspase recruitment domain-containing NLR family. This gene plays a role in cytokine response and antiviral immunity through its inhibition of NF-kappa-B activation and negative regulation of type I interferon signaling pathways. [provided by RefSeq, Oct 2011]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit normal cytokine production induced by virus and bacteria infection. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 75 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700067K01Rik T C 8: 84,004,007 S227P probably damaging Het
4930444G20Rik A G 10: 22,067,886 L65P probably damaging Het
9130019O22Rik A T 7: 127,384,346 I528K possibly damaging Het
Acot6 A G 12: 84,106,527 H181R probably benign Het
Adam15 A T 3: 89,346,937 H184Q probably benign Het
Agl A G 3: 116,793,820 F29L probably benign Het
Ak7 A G 12: 105,742,243 Y319C probably benign Het
Ano8 C A 8: 71,479,025 V813L probably benign Het
Apbb2 T G 5: 66,451,603 K234Q probably damaging Het
Arfgef3 A T 10: 18,646,462 D605E probably damaging Het
Bfsp2 C A 9: 103,432,666 R340L probably damaging Het
Birc6 C A 17: 74,640,108 P2956T probably damaging Het
C1rb T C 6: 124,577,427 I389T probably benign Het
Ccdc146 A G 5: 21,308,626 F498S probably benign Het
Cdc14b A C 13: 64,210,198 V361G possibly damaging Het
Cdc25b A T 2: 131,191,632 I164F probably damaging Het
Col18a1 A G 10: 77,085,276 S297P unknown Het
Col3a1 A T 1: 45,322,418 I117F unknown Het
Cox4i2 AG A 2: 152,760,698 probably null Het
Crybg3 C A 16: 59,558,890 G667V probably benign Het
Ctc1 A G 11: 69,029,741 D623G probably damaging Het
Dennd1a A T 2: 38,039,203 H152Q probably damaging Het
Dgke G A 11: 89,041,480 P495S probably damaging Het
Dll3 A T 7: 28,298,905 C212S possibly damaging Het
Dll4 A T 2: 119,328,573 S235C probably damaging Het
Dnah12 G A 14: 26,778,912 probably null Het
Dnah12 A T 14: 26,781,485 T1599S probably damaging Het
Elavl1 G A 8: 4,311,712 T20M probably damaging Het
Epha3 T C 16: 63,652,332 T397A probably benign Het
Fanca A T 8: 123,286,477 I859N probably damaging Het
Fzd1 A T 5: 4,755,980 V534D probably damaging Het
Glmp A G 3: 88,326,610 Y258C probably damaging Het
Gm9195 G A 14: 72,474,186 P329S probably damaging Het
Gm9573 AGCTGGATGCAGTGGTGGTCAGGGTGGGTGTAGAGCCTGAGCCAGTGCTGGATACAGTGGTGGTC AGCTGGATACAGTGGTGGTC 17: 35,621,213 probably benign Het
Gpt A G 15: 76,698,999 R379G probably benign Het
Gsdmc2 T C 15: 63,825,054 T423A probably damaging Het
Hemgn T C 4: 46,397,054 K61E possibly damaging Het
Ikzf4 A T 10: 128,643,890 S56T possibly damaging Het
Jak1 T C 4: 101,175,135 T425A probably benign Het
Jsrp1 T C 10: 80,810,485 T80A probably benign Het
Klra9 T A 6: 130,188,680 D124V possibly damaging Het
Lama5 A T 2: 180,202,177 V397D probably damaging Het
Lrp2 A G 2: 69,472,533 S2951P probably benign Het
Map7d1 A G 4: 126,256,015 probably null Het
Mcm6 A T 1: 128,338,127 C636S probably damaging Het
Mia T C 7: 27,180,933 E39G possibly damaging Het
Mpeg1 T A 19: 12,462,894 I572N probably damaging Het
Muc6 AGGCGCAGAAACCCTGGC AGGC 7: 141,634,450 probably null Het
Mup5 A G 4: 61,833,755 Y86H probably damaging Het
Nckap5 A T 1: 126,026,367 V816D probably benign Het
Nfib T C 4: 82,296,815 probably null Het
Nynrin G C 14: 55,872,733 E1766Q probably damaging Het
Olfr39 A T 9: 20,285,804 Y43F probably benign Het
Oxct1 T A 15: 4,094,042 L328Q probably damaging Het
Pax5 T A 4: 44,679,485 I187F possibly damaging Het
Pcdhb4 A T 18: 37,309,239 D534V probably damaging Het
Pebp4 C T 14: 69,847,597 P35S probably benign Het
Pkhd1l1 T A 15: 44,523,553 V1274E possibly damaging Het
Plcz1 A T 6: 140,010,424 V373D probably benign Het
Plxnb1 C T 9: 109,100,175 T33I probably damaging Het
Prag1 T C 8: 36,146,761 C1156R probably benign Het
Ptprc T A 1: 138,117,862 I87F probably benign Het
Rbp4 G A 19: 38,124,103 T138I possibly damaging Het
Slc12a1 A T 2: 125,200,622 N733Y possibly damaging Het
Slc27a3 A G 3: 90,389,726 V22A probably benign Het
Tcaf1 T C 6: 42,675,039 probably null Het
Tnc T C 4: 63,971,155 probably null Het
Tspan31 A T 10: 127,068,118 *211R probably null Het
Ttc17 A T 2: 94,362,428 V86D possibly damaging Het
Ubr1 T A 2: 120,904,077 N1114I possibly damaging Het
Ulk2 C T 11: 61,783,631 G850R probably benign Het
Vmn1r13 T A 6: 57,210,156 I100N probably benign Het
Zan T C 5: 137,427,978 D2512G unknown Het
Zc3h14 A T 12: 98,771,356 N34I probably damaging Het
Zcwpw1 T G 5: 137,812,084 L374R probably damaging Het
Other mutations in Nlrc5
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00158:Nlrc5 APN 8 94502211 splice site probably benign
IGL00232:Nlrc5 APN 8 94484623 critical splice donor site probably null
IGL00324:Nlrc5 APN 8 94521479 missense probably damaging 1.00
IGL02715:Nlrc5 APN 8 94474668 missense probably damaging 1.00
IGL02992:Nlrc5 APN 8 94506573 missense possibly damaging 0.69
IGL03095:Nlrc5 APN 8 94521908 splice site probably benign
IGL03389:Nlrc5 APN 8 94521474 missense probably damaging 1.00
IGL03406:Nlrc5 APN 8 94476855 missense probably benign 0.01
cowberry UTSW 8 94491525 missense possibly damaging 0.83
lingon UTSW 8 94481860 missense probably damaging 1.00
R0037:Nlrc5 UTSW 8 94489535 missense probably benign 0.00
R0048:Nlrc5 UTSW 8 94474656 missense possibly damaging 0.81
R0092:Nlrc5 UTSW 8 94489594 splice site probably benign
R0506:Nlrc5 UTSW 8 94493125 splice site probably benign
R0548:Nlrc5 UTSW 8 94521783 missense probably null 0.09
R2014:Nlrc5 UTSW 8 94525510 splice site probably benign
R3051:Nlrc5 UTSW 8 94476715 missense probably benign 0.01
R3776:Nlrc5 UTSW 8 94472839 missense possibly damaging 0.48
R3837:Nlrc5 UTSW 8 94511301 splice site probably benign
R4012:Nlrc5 UTSW 8 94475992 missense possibly damaging 0.92
R4367:Nlrc5 UTSW 8 94476564 missense probably damaging 1.00
R4400:Nlrc5 UTSW 8 94494353 missense probably benign 0.08
R4469:Nlrc5 UTSW 8 94520839 missense probably damaging 1.00
R4561:Nlrc5 UTSW 8 94477146 missense probably damaging 1.00
R4584:Nlrc5 UTSW 8 94477275 missense probably damaging 0.96
R4758:Nlrc5 UTSW 8 94512328 missense possibly damaging 0.70
R4834:Nlrc5 UTSW 8 94505485 missense probably benign 0.00
R4896:Nlrc5 UTSW 8 94521216 unclassified probably benign
R5004:Nlrc5 UTSW 8 94521216 unclassified probably benign
R5018:Nlrc5 UTSW 8 94525452 missense probably damaging 1.00
R5115:Nlrc5 UTSW 8 94476819 missense possibly damaging 0.67
R5116:Nlrc5 UTSW 8 94481860 missense probably damaging 1.00
R5126:Nlrc5 UTSW 8 94474671 missense possibly damaging 0.95
R5148:Nlrc5 UTSW 8 94476693 missense probably damaging 1.00
R5224:Nlrc5 UTSW 8 94494316 missense probably benign 0.26
R5527:Nlrc5 UTSW 8 94490416 missense probably damaging 1.00
R5640:Nlrc5 UTSW 8 94475793 missense probably benign 0.02
R5705:Nlrc5 UTSW 8 94475757 missense probably benign 0.00
R5778:Nlrc5 UTSW 8 94479526 missense possibly damaging 0.66
R5830:Nlrc5 UTSW 8 94472914 missense probably damaging 1.00
R5850:Nlrc5 UTSW 8 94521047 missense probably benign 0.00
R5978:Nlrc5 UTSW 8 94488593 missense probably damaging 0.98
R6335:Nlrc5 UTSW 8 94502274 missense probably benign 0.01
R6372:Nlrc5 UTSW 8 94479750 missense probably damaging 0.98
R6486:Nlrc5 UTSW 8 94521299 splice site probably null
R6765:Nlrc5 UTSW 8 94490368 missense probably benign 0.20
R6861:Nlrc5 UTSW 8 94521229 unclassified probably benign
R6869:Nlrc5 UTSW 8 94521955 missense probably benign 0.00
R7134:Nlrc5 UTSW 8 94479722 missense probably damaging 0.99
R7231:Nlrc5 UTSW 8 94521805 critical splice donor site probably null
R7309:Nlrc5 UTSW 8 94474042 missense probably benign 0.01
R7368:Nlrc5 UTSW 8 94476393 nonsense probably null
R7497:Nlrc5 UTSW 8 94521970 missense probably damaging 1.00
Z1088:Nlrc5 UTSW 8 94504464 missense possibly damaging 0.48
Predicted Primers PCR Primer
(F):5'- ACAGCTGTGCAGTGAAGTTG -3'
(R):5'- TGGTACCATGGAGCCACAAAC -3'

Sequencing Primer
(F):5'- GGGGAGGGTTGTGATGGTC -3'
(R):5'- GGAGCCACAAACTTTACTGATTC -3'
Posted On2019-06-26