Incidental Mutation 'R0593:Dcaf17'
ID56048
Institutional Source Beutler Lab
Gene Symbol Dcaf17
Ensembl Gene ENSMUSG00000041966
Gene NameDDB1 and CUL4 associated factor 17
Synonyms
MMRRC Submission 038783-MU
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.516) question?
Stock #R0593 (G1)
Quality Score174
Status Validated
Chromosome2
Chromosomal Location71055328-71099142 bp(+) (GRCm38)
Type of Mutationcritical splice donor site (2 bp from exon)
DNA Base Change (assembly) T to A at 71087400 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000120016 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000064141] [ENSMUST00000102701] [ENSMUST00000112159] [ENSMUST00000112167] [ENSMUST00000154704]
Predicted Effect probably null
Transcript: ENSMUST00000064141
Predicted Effect probably null
Transcript: ENSMUST00000102701
Predicted Effect probably benign
Transcript: ENSMUST00000112159
Predicted Effect probably benign
Transcript: ENSMUST00000112167
Predicted Effect probably benign
Transcript: ENSMUST00000130292
SMART Domains Protein: ENSMUSP00000117830
Gene: ENSMUSG00000041966

DomainStartEndE-ValueType
Pfam:DCAF17 55 405 6.6e-166 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000154704
Meta Mutation Damage Score 0.9490 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 96.9%
  • 20x: 93.4%
Validation Efficiency 100% (39/39)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a nuclear transmembrane protein that associates with cullin 4A/damaged DNA binding protein 1 ubiquitin ligase complex. Mutations in this gene are associated with Woodhouse-Sakati syndrome. Alternate splicing results in multiple transcript variants. [provided by RefSeq, Sep 2009]
Allele List at MGI
Other mutations in this stock
Total: 33 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca8a T C 11: 110,068,099 D733G probably damaging Het
Acmsd T C 1: 127,738,603 probably benign Het
Adam34 T C 8: 43,651,687 Y307C possibly damaging Het
Alox12e A G 11: 70,320,897 probably benign Het
Ankrd50 C A 3: 38,483,007 G29* probably null Het
Arhgap17 T C 7: 123,286,743 probably benign Het
Asah1 A G 8: 41,349,582 M141T probably benign Het
Atg2a GCCTTCCTTCCTTCCTTCCTTCCTTCCTTCCTTCC GCCTTCCTTCCTTCCTTCCTTCCTTCCTTCCTTCCTTCC 19: 6,245,007 probably benign Het
Bsn A T 9: 108,110,306 I2749N unknown Het
Cds2 G A 2: 132,297,376 probably benign Het
Ckmt2 A G 13: 91,853,638 V384A probably damaging Het
Clock A G 5: 76,265,836 S71P probably benign Het
Cops6 A G 5: 138,163,580 T96A probably benign Het
Csnka2ip A T 16: 64,478,612 V19D probably damaging Het
Dscam T C 16: 96,772,408 K785E probably benign Het
Eif2d T A 1: 131,155,728 probably benign Het
Gal3st2b T C 1: 93,940,827 V258A probably benign Het
Gucy2c T C 6: 136,728,335 N534S probably damaging Het
Hook1 C T 4: 95,998,786 T210I possibly damaging Het
Ifi203 T C 1: 173,928,649 probably benign Het
Irf7 T C 7: 141,265,062 probably benign Het
Lrp2 C T 2: 69,467,006 V3204I probably benign Het
Mtx2 A G 2: 74,869,436 probably benign Het
Nelfcd G T 2: 174,423,430 V248L probably benign Het
Olfr1349 T A 7: 6,514,809 N207Y probably benign Het
Oosp1 T C 19: 11,668,412 S121G probably benign Het
Sec16b G C 1: 157,532,148 G164R probably benign Het
Slc22a14 T A 9: 119,169,851 D561V probably benign Het
Tet2 G A 3: 133,488,109 T188I probably benign Het
Tex10 C T 4: 48,456,800 R637Q probably benign Het
Trp53bp1 A G 2: 121,270,528 V63A possibly damaging Het
Ube2d2a T G 18: 35,770,385 probably benign Het
Vmn1r113 T A 7: 20,787,463 V60E probably damaging Het
Other mutations in Dcaf17
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00093:Dcaf17 APN 2 71078159 missense probably benign 0.03
IGL01125:Dcaf17 APN 2 71089805 missense probably benign 0.03
IGL01761:Dcaf17 APN 2 71056537 missense probably damaging 1.00
IGL02641:Dcaf17 APN 2 71082031 missense probably damaging 1.00
R0081:Dcaf17 UTSW 2 71078468 splice site probably benign
R0388:Dcaf17 UTSW 2 71078571 missense probably benign 0.02
R0637:Dcaf17 UTSW 2 71060419 missense probably damaging 0.99
R0661:Dcaf17 UTSW 2 71088435 missense probably damaging 1.00
R1281:Dcaf17 UTSW 2 71078156 missense probably damaging 1.00
R1454:Dcaf17 UTSW 2 71073173 missense probably damaging 1.00
R1501:Dcaf17 UTSW 2 71081988 missense probably damaging 1.00
R1908:Dcaf17 UTSW 2 71060369 nonsense probably null
R1919:Dcaf17 UTSW 2 71078172 splice site probably null
R2882:Dcaf17 UTSW 2 71082027 missense possibly damaging 0.96
R4585:Dcaf17 UTSW 2 71088580 missense probably benign 0.00
R4586:Dcaf17 UTSW 2 71088580 missense probably benign 0.00
R6093:Dcaf17 UTSW 2 71082012 missense possibly damaging 0.51
R7070:Dcaf17 UTSW 2 71088513 missense probably benign 0.00
R8289:Dcaf17 UTSW 2 71055374 missense
R8418:Dcaf17 UTSW 2 71088373 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GCCTTTAGTGTATAAGCTGAGGCCC -3'
(R):5'- TGTGAAAACTGCAATGAGACCCCAG -3'

Sequencing Primer
(F):5'- GAGGTTTCTGAACTCAGATCCAC -3'
(R):5'- ACCCCAGAAGGGGGTGAC -3'
Posted On2013-07-11