Incidental Mutation 'R0593:Cds2'
ID56051
Institutional Source Beutler Lab
Gene Symbol Cds2
Ensembl Gene ENSMUSG00000058793
Gene NameCDP-diacylglycerol synthase (phosphatidate cytidylyltransferase) 2
Synonyms5730460C18Rik, 5730450N06Rik, D2Wsu127e
MMRRC Submission 038783-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R0593 (G1)
Quality Score225
Status Validated
Chromosome2
Chromosomal Location132263148-132312050 bp(+) (GRCm38)
Type of Mutationunclassified
DNA Base Change (assembly) G to A at 132297376 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000135497 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000089461] [ENSMUST00000103181] [ENSMUST00000110158] [ENSMUST00000125060] [ENSMUST00000147456]
Predicted Effect probably benign
Transcript: ENSMUST00000089461
SMART Domains Protein: ENSMUSP00000086886
Gene: ENSMUSG00000058793

DomainStartEndE-ValueType
Pfam:CTP_transf_1 52 382 5e-90 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000103181
SMART Domains Protein: ENSMUSP00000099470
Gene: ENSMUSG00000058793

DomainStartEndE-ValueType
Pfam:CTP_transf_1 69 399 7.6e-90 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000110158
SMART Domains Protein: ENSMUSP00000105786
Gene: ENSMUSG00000058793

DomainStartEndE-ValueType
Pfam:CTP_transf_1 69 129 3.4e-14 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000125060
Predicted Effect probably benign
Transcript: ENSMUST00000138194
SMART Domains Protein: ENSMUSP00000121769
Gene: ENSMUSG00000058793

DomainStartEndE-ValueType
Pfam:CTP_transf_1 3 126 8.7e-34 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000147456
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 96.9%
  • 20x: 93.4%
Validation Efficiency 100% (39/39)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Breakdown products of phosphoinositides are ubiquitous second messengers that function downstream of many G protein-coupled receptors and tyrosine kinases regulating cell growth, calcium metabolism, and protein kinase C activity. This gene encodes an enzyme which regulates the amount of phosphatidylinositol available for signaling by catalyzing the conversion of phosphatidic acid to CDP-diacylglycerol. This enzyme is an integral membrane protein localized to two subcellular domains, the matrix side of the inner mitochondrial membrane where it is thought to be involved in the synthesis of phosphatidylglycerol and cardiolipin and the cytoplasmic side of the endoplasmic reticulum where it functions in phosphatidylinositol biosynthesis. Two genes encoding this enzyme have been identified in humans, one mapping to human chromosome 4q21 and a second to 20p13. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for disruptions in this gene display a lethal phenotype. Heterozygotes show a distorted lymphocyte distribution and enhanced sensorimotor gating. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 33 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca8a T C 11: 110,068,099 D733G probably damaging Het
Acmsd T C 1: 127,738,603 probably benign Het
Adam34 T C 8: 43,651,687 Y307C possibly damaging Het
Alox12e A G 11: 70,320,897 probably benign Het
Ankrd50 C A 3: 38,483,007 G29* probably null Het
Arhgap17 T C 7: 123,286,743 probably benign Het
Asah1 A G 8: 41,349,582 M141T probably benign Het
Atg2a GCCTTCCTTCCTTCCTTCCTTCCTTCCTTCCTTCC GCCTTCCTTCCTTCCTTCCTTCCTTCCTTCCTTCCTTCC 19: 6,245,007 probably benign Het
Bsn A T 9: 108,110,306 I2749N unknown Het
Ckmt2 A G 13: 91,853,638 V384A probably damaging Het
Clock A G 5: 76,265,836 S71P probably benign Het
Cops6 A G 5: 138,163,580 T96A probably benign Het
Csnka2ip A T 16: 64,478,612 V19D probably damaging Het
Dcaf17 T A 2: 71,087,400 probably null Het
Dscam T C 16: 96,772,408 K785E probably benign Het
Eif2d T A 1: 131,155,728 probably benign Het
Gal3st2b T C 1: 93,940,827 V258A probably benign Het
Gucy2c T C 6: 136,728,335 N534S probably damaging Het
Hook1 C T 4: 95,998,786 T210I possibly damaging Het
Ifi203 T C 1: 173,928,649 probably benign Het
Irf7 T C 7: 141,265,062 probably benign Het
Lrp2 C T 2: 69,467,006 V3204I probably benign Het
Mtx2 A G 2: 74,869,436 probably benign Het
Nelfcd G T 2: 174,423,430 V248L probably benign Het
Olfr1349 T A 7: 6,514,809 N207Y probably benign Het
Oosp1 T C 19: 11,668,412 S121G probably benign Het
Sec16b G C 1: 157,532,148 G164R probably benign Het
Slc22a14 T A 9: 119,169,851 D561V probably benign Het
Tet2 G A 3: 133,488,109 T188I probably benign Het
Tex10 C T 4: 48,456,800 R637Q probably benign Het
Trp53bp1 A G 2: 121,270,528 V63A possibly damaging Het
Ube2d2a T G 18: 35,770,385 probably benign Het
Vmn1r113 T A 7: 20,787,463 V60E probably damaging Het
Other mutations in Cds2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00433:Cds2 APN 2 132297293 missense probably damaging 1.00
IGL00434:Cds2 APN 2 132293351 missense probably damaging 0.99
IGL00771:Cds2 APN 2 132304352 splice site probably benign
IGL00984:Cds2 APN 2 132298521 missense probably benign 0.02
IGL02041:Cds2 APN 2 132294443 missense possibly damaging 0.94
sugarless UTSW 2 132298483 missense probably damaging 1.00
R0045:Cds2 UTSW 2 132305155 missense possibly damaging 0.67
R0045:Cds2 UTSW 2 132305155 missense possibly damaging 0.67
R0452:Cds2 UTSW 2 132298479 missense probably damaging 0.99
R0455:Cds2 UTSW 2 132285967 critical splice donor site probably null
R0831:Cds2 UTSW 2 132285967 critical splice donor site probably null
R1053:Cds2 UTSW 2 132305260 missense probably damaging 1.00
R1669:Cds2 UTSW 2 132295519 splice site probably null
R1740:Cds2 UTSW 2 132302213 missense possibly damaging 0.63
R1859:Cds2 UTSW 2 132302195 missense probably damaging 1.00
R4125:Cds2 UTSW 2 132297271 missense probably benign 0.00
R4126:Cds2 UTSW 2 132297271 missense probably benign 0.00
R4128:Cds2 UTSW 2 132297271 missense probably benign 0.00
R4352:Cds2 UTSW 2 132263445 start codon destroyed probably null 0.37
R4467:Cds2 UTSW 2 132294446 nonsense probably null
R4698:Cds2 UTSW 2 132304953 missense probably damaging 0.97
R4704:Cds2 UTSW 2 132300602 nonsense probably null
R4917:Cds2 UTSW 2 132298478 missense probably damaging 0.98
R5070:Cds2 UTSW 2 132302088 nonsense probably null
R5199:Cds2 UTSW 2 132298483 missense probably damaging 1.00
R5431:Cds2 UTSW 2 132302170 missense probably benign 0.28
R5704:Cds2 UTSW 2 132293329 missense probably benign 0.01
R5858:Cds2 UTSW 2 132302113 missense probably benign 0.00
R5946:Cds2 UTSW 2 132297248 missense probably damaging 1.00
R5954:Cds2 UTSW 2 132297271 missense probably benign 0.00
R7195:Cds2 UTSW 2 132293284 missense probably benign 0.28
R7234:Cds2 UTSW 2 132304480 critical splice donor site probably null
R7413:Cds2 UTSW 2 132293315 missense probably benign 0.03
Predicted Primers PCR Primer
(F):5'- CGTGAAGGAGAGCTGCACAAACTC -3'
(R):5'- GCACGCTCCTCTTACCATGTAGAAC -3'

Sequencing Primer
(F):5'- GAGCTGCACAAACTCTACTGG -3'
(R):5'- GCAGCCGATAATGCTTCTTAAC -3'
Posted On2013-07-11