Incidental Mutation 'R7205:Map6'
ID 560525
Institutional Source Beutler Lab
Gene Symbol Map6
Ensembl Gene ENSMUSG00000055407
Gene Name microtubule-associated protein 6
Synonyms Mtap6, 2810411E12Rik, F-STOP, STOP
MMRRC Submission 045283-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.107) question?
Stock # R7205 (G1)
Quality Score 225.009
Status Validated
Chromosome 7
Chromosomal Location 98916654-98986344 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) C to A at 98918257 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Histidine to Glutamine at position 343 (H343Q)
Ref Sequence ENSEMBL: ENSMUSP00000064787 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000068973] [ENSMUST00000107100] [ENSMUST00000122101] [ENSMUST00000127492] [ENSMUST00000207883] [ENSMUST00000208605] [ENSMUST00000208924]
AlphaFold Q7TSJ2
Predicted Effect probably benign
Transcript: ENSMUST00000068973
AA Change: H343Q

PolyPhen 2 Score 0.005 (Sensitivity: 0.97; Specificity: 0.74)
SMART Domains Protein: ENSMUSP00000064787
Gene: ENSMUSG00000055407
AA Change: H343Q

DomainStartEndE-ValueType
low complexity region 42 57 N/A INTRINSIC
low complexity region 93 117 N/A INTRINSIC
internal_repeat_1 191 306 6.21e-27 PROSPERO
internal_repeat_1 302 398 6.21e-27 PROSPERO
low complexity region 501 525 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000107100
AA Change: H140Q

PolyPhen 2 Score 0.608 (Sensitivity: 0.87; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000102717
Gene: ENSMUSG00000055407
AA Change: H140Q

DomainStartEndE-ValueType
low complexity region 12 26 N/A INTRINSIC
internal_repeat_1 28 103 5.9e-29 PROSPERO
internal_repeat_1 120 195 5.9e-29 PROSPERO
Predicted Effect possibly damaging
Transcript: ENSMUST00000122101
AA Change: H343Q

PolyPhen 2 Score 0.608 (Sensitivity: 0.87; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000113183
Gene: ENSMUSG00000055407
AA Change: H343Q

DomainStartEndE-ValueType
Pfam:STOP 1 184 1.2e-18 PFAM
internal_repeat_1 191 306 1.99e-35 PROSPERO
internal_repeat_1 302 398 1.99e-35 PROSPERO
Predicted Effect probably benign
Transcript: ENSMUST00000127492
AA Change: H343Q

PolyPhen 2 Score 0.005 (Sensitivity: 0.97; Specificity: 0.74)
Predicted Effect probably benign
Transcript: ENSMUST00000207883
AA Change: H343Q

PolyPhen 2 Score 0.005 (Sensitivity: 0.97; Specificity: 0.74)
Predicted Effect possibly damaging
Transcript: ENSMUST00000208605
AA Change: H140Q

PolyPhen 2 Score 0.608 (Sensitivity: 0.87; Specificity: 0.91)
Predicted Effect probably benign
Transcript: ENSMUST00000208924
AA Change: H140Q

PolyPhen 2 Score 0.005 (Sensitivity: 0.97; Specificity: 0.74)
Meta Mutation Damage Score 0.1368 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency 97% (99/102)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a microtubule-associated protein. The encoded protein is a calmodulin-binding and calmodulin-regulated protein that is involved in microtubule stabilization. Two transcript variants encoding distinct isoforms have been identified for this gene. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a targeted null mutation are devoid of cold-stable microtubules, and exhibit impaired synaptic plasticity, associated with severe behavioral abnormalities that are specifically ameliorated by long-term administration of neuroleptics. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 101 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca15 A T 7: 119,993,587 (GRCm39) K1269M possibly damaging Het
Adgrl2 A T 3: 148,564,585 (GRCm39) Y332N probably damaging Het
Adgrv1 C T 13: 81,627,777 (GRCm39) V3695I probably benign Het
Aldh1l1 A T 6: 90,575,257 (GRCm39) Y848F probably damaging Het
Ambra1 T C 2: 91,598,103 (GRCm39) V88A possibly damaging Het
Ankrd12 C T 17: 66,292,160 (GRCm39) R1091Q probably damaging Het
Apob T G 12: 8,055,087 (GRCm39) V1362G probably damaging Het
Arhgap17 A G 7: 122,905,661 (GRCm39) L328P probably damaging Het
Arhgap27 A C 11: 103,235,367 (GRCm39) V9G probably benign Het
Arhgap33 A T 7: 30,232,434 (GRCm39) D34E probably damaging Het
Ash1l A G 3: 88,873,259 (GRCm39) D14G probably benign Het
Atf6b T C 17: 34,872,703 (GRCm39) Y575H probably damaging Het
Bcl2l2 T G 14: 55,122,058 (GRCm39) S74A probably benign Het
Begain T C 12: 109,004,794 (GRCm39) T73A possibly damaging Het
Bicdl1 C T 5: 115,808,340 (GRCm39) R264Q probably damaging Het
Ccdc180 A G 4: 45,914,588 (GRCm39) D701G probably benign Het
Cd200r4 G T 16: 44,653,529 (GRCm39) V146L probably damaging Het
Cd226 G A 18: 89,265,322 (GRCm39) C200Y probably damaging Het
Cdcp3 T C 7: 130,879,352 (GRCm39) probably null Het
Cdhr18 T C 14: 13,866,032 (GRCm38) T286A Het
Cdk12 A G 11: 98,115,451 (GRCm39) N864S unknown Het
Cfhr4 A T 1: 139,680,788 (GRCm39) Y243* probably null Het
Clcnkb A T 4: 141,135,946 (GRCm39) L413Q probably damaging Het
Cldn10 T C 14: 119,099,255 (GRCm39) V123A possibly damaging Het
Cnn1 T A 9: 22,017,078 (GRCm39) probably null Het
Cpa5 C A 6: 30,630,829 (GRCm39) Q364K probably benign Het
Cstdc5 T C 16: 36,187,809 (GRCm39) I19V probably benign Het
Ddx11 A G 17: 66,437,766 (GRCm39) E164G probably benign Het
Dnah12 G A 14: 26,500,869 (GRCm39) probably null Het
Drc7 T A 8: 95,804,549 (GRCm39) Y855N probably damaging Het
Fam20b C A 1: 156,529,968 (GRCm39) probably null Het
Fip1l1 T A 5: 74,748,736 (GRCm39) probably null Het
Flt4 A G 11: 49,525,125 (GRCm39) D657G probably null Het
Fmo3 T A 1: 162,781,857 (GRCm39) T499S possibly damaging Het
Fyco1 C T 9: 123,651,491 (GRCm39) G1190S probably benign Het
Galnt17 C A 5: 131,335,590 (GRCm39) probably benign Het
Ggcx T C 6: 72,404,987 (GRCm39) I465T probably damaging Het
Gm7361 T A 5: 26,466,116 (GRCm39) N159K probably damaging Het
Golgb1 A G 16: 36,695,663 (GRCm39) N54S unknown Het
Grin2c G A 11: 115,141,876 (GRCm39) P848S probably damaging Het
Grina T C 15: 76,133,287 (GRCm39) V285A probably damaging Het
Gtpbp6 A G 5: 110,252,478 (GRCm39) L381P probably damaging Het
Herc2 G T 7: 55,832,388 (GRCm39) G3028V probably damaging Het
Ibsp A T 5: 104,458,297 (GRCm39) Y278F probably damaging Het
Ints4 T A 7: 97,184,433 (GRCm39) L846* probably null Het
Kif17 A G 4: 138,021,077 (GRCm39) K849E probably benign Het
Krt77 G A 15: 101,777,806 (GRCm39) P83L probably benign Het
Ky T G 9: 102,419,491 (GRCm39) D499E probably damaging Het
Lrp3 A T 7: 34,902,051 (GRCm39) M610K probably damaging Het
Lrrfip1 T A 1: 91,019,338 (GRCm39) D156E probably benign Het
Micu2 G T 14: 58,191,606 (GRCm39) D148E probably benign Het
Mks1 T A 11: 87,747,428 (GRCm39) S153T probably benign Het
Msantd5f3 A G 4: 73,573,157 (GRCm39) Y132C probably damaging Het
Muc6 AGGCGCAGAAACCCTGGC AGGC 7: 141,214,363 (GRCm39) probably null Het
Myh9 T C 15: 77,667,672 (GRCm39) K587R probably benign Het
Neb T C 2: 52,086,368 (GRCm39) Y5478C probably damaging Het
Nelfe G A 17: 35,069,912 (GRCm39) probably null Het
Nps T A 7: 134,870,510 (GRCm39) L11I probably damaging Het
Nsd1 A T 13: 55,394,283 (GRCm39) D731V probably damaging Het
Nup50 A G 15: 84,817,859 (GRCm39) T93A probably benign Het
Nup98 A T 7: 101,844,248 (GRCm39) F29Y unknown Het
Oprd1 A G 4: 131,841,112 (GRCm39) I282T probably damaging Het
Or4c103 T C 2: 88,513,767 (GRCm39) H103R possibly damaging Het
Or5p50 T C 7: 107,421,782 (GRCm39) N298S probably benign Het
Or6b3 A T 1: 92,439,573 (GRCm39) M59K probably benign Het
Or6d12 A G 6: 116,492,936 (GRCm39) Y66C probably damaging Het
Osbp2 T C 11: 3,662,134 (GRCm39) I240V probably damaging Het
Otub2 C A 12: 103,359,163 (GRCm39) P84Q probably benign Het
Parp9 A T 16: 35,777,360 (GRCm39) I435F probably benign Het
Pcdh18 C T 3: 49,709,923 (GRCm39) R464H probably benign Het
Pcsk6 G T 7: 65,675,156 (GRCm39) probably null Het
Ptgs2 G A 1: 149,978,512 (GRCm39) R208Q probably benign Het
Rab11b G A 17: 33,968,841 (GRCm39) R51C probably damaging Het
Rad1 A G 15: 10,493,343 (GRCm39) I257V probably benign Het
Rbms3 C T 9: 116,415,085 (GRCm39) probably null Het
Rxfp2 A T 5: 149,983,364 (GRCm39) I300L probably benign Het
Rxfp2 C A 5: 149,983,368 (GRCm39) T301K probably benign Het
Sars2 G T 7: 28,443,733 (GRCm39) A112S probably benign Het
Scn10a T C 9: 119,442,616 (GRCm39) D1543G probably damaging Het
Serpinb1b A G 13: 33,271,406 (GRCm39) H59R probably benign Het
Sgsm2 T A 11: 74,745,319 (GRCm39) D661V possibly damaging Het
Smad6 C A 9: 63,927,688 (GRCm39) V207L probably damaging Het
Son TCCCCCAGCCGCAGGAGCCGAACCCCCAGCCGCAGGAGCAGAACCCCCAGCCGCAGGAGCCGAACCCCCAGCCGCAGGAGCCGAACCCCCAGCCGCAGGAGCCGAACCCCCAGCCG TCCCCCAGCCGCAGGAGCCGAACCCCCAGCCGCAGGAGCCGAACCCCCAGCCGCAGGAGCCGAACCCCCAGCCG 16: 91,457,183 (GRCm39) probably benign Het
Spata31h1 A T 10: 82,125,161 (GRCm39) D2616E probably benign Het
Tenm2 C T 11: 35,939,956 (GRCm39) R1390Q probably damaging Het
Tmem132a T A 19: 10,844,295 (GRCm39) Q101L probably damaging Het
Tmem151a A G 19: 5,132,801 (GRCm39) V135A probably damaging Het
Trappc10 T C 10: 78,046,262 (GRCm39) K443E probably damaging Het
Trrap A T 5: 144,779,517 (GRCm39) N3161I possibly damaging Het
Tspan32 G T 7: 142,558,863 (GRCm39) R6L possibly damaging Het
Tut7 C G 13: 59,936,364 (GRCm39) D1246H probably damaging Het
Ugt2a2 T C 5: 87,608,468 (GRCm39) D457G possibly damaging Het
Ulk2 A T 11: 61,725,657 (GRCm39) S140T possibly damaging Het
Upf1 C T 8: 70,792,695 (GRCm39) A338T possibly damaging Het
Usp43 C T 11: 67,774,110 (GRCm39) R460Q probably null Het
Uxs1 A G 1: 43,856,118 (GRCm39) probably benign Het
Vmn1r59 A G 7: 5,457,725 (GRCm39) C12R probably damaging Het
Wdr64 A G 1: 175,617,499 (GRCm39) D693G probably benign Het
Wnk1 A T 6: 119,920,839 (GRCm39) probably null Het
Wnt2 G T 6: 18,028,046 (GRCm39) R63S probably benign Het
Zfp418 A T 7: 7,184,562 (GRCm39) Q175L probably benign Het
Other mutations in Map6
AlleleSourceChrCoordTypePredicted EffectPPH Score
R0035:Map6 UTSW 7 98,966,815 (GRCm39) missense probably damaging 1.00
R0035:Map6 UTSW 7 98,966,815 (GRCm39) missense probably damaging 1.00
R0118:Map6 UTSW 7 98,966,824 (GRCm39) missense possibly damaging 0.53
R0125:Map6 UTSW 7 98,985,187 (GRCm39) splice site probably null
R0244:Map6 UTSW 7 98,986,043 (GRCm39) missense probably benign 0.00
R0973:Map6 UTSW 7 98,985,950 (GRCm39) missense possibly damaging 0.78
R0973:Map6 UTSW 7 98,985,950 (GRCm39) missense possibly damaging 0.78
R0974:Map6 UTSW 7 98,985,950 (GRCm39) missense possibly damaging 0.78
R1455:Map6 UTSW 7 98,917,421 (GRCm39) missense probably damaging 1.00
R1678:Map6 UTSW 7 98,917,305 (GRCm39) missense probably damaging 1.00
R1696:Map6 UTSW 7 98,966,664 (GRCm39) splice site probably null
R1866:Map6 UTSW 7 98,965,083 (GRCm39) missense probably damaging 1.00
R2061:Map6 UTSW 7 98,966,679 (GRCm39) missense probably damaging 1.00
R3236:Map6 UTSW 7 98,986,031 (GRCm39) missense probably damaging 1.00
R3625:Map6 UTSW 7 98,918,402 (GRCm39) missense possibly damaging 0.60
R4044:Map6 UTSW 7 98,917,256 (GRCm39) missense probably damaging 1.00
R4570:Map6 UTSW 7 98,985,763 (GRCm39) missense possibly damaging 0.49
R5056:Map6 UTSW 7 98,985,859 (GRCm39) missense probably benign 0.05
R5065:Map6 UTSW 7 98,985,917 (GRCm39) missense probably benign 0.02
R5656:Map6 UTSW 7 98,985,505 (GRCm39) missense probably damaging 1.00
R6101:Map6 UTSW 7 98,917,314 (GRCm39) missense probably damaging 1.00
R6105:Map6 UTSW 7 98,917,314 (GRCm39) missense probably damaging 1.00
R6302:Map6 UTSW 7 98,985,314 (GRCm39) missense probably damaging 0.99
R6450:Map6 UTSW 7 98,917,245 (GRCm39) missense probably damaging 1.00
R6915:Map6 UTSW 7 98,917,454 (GRCm39) missense probably damaging 1.00
R7223:Map6 UTSW 7 98,917,232 (GRCm39) missense probably damaging 1.00
R7293:Map6 UTSW 7 98,985,740 (GRCm39) missense possibly damaging 0.49
R7481:Map6 UTSW 7 98,918,345 (GRCm39) missense possibly damaging 0.57
R7489:Map6 UTSW 7 98,917,268 (GRCm39) missense probably damaging 1.00
R7691:Map6 UTSW 7 98,985,499 (GRCm39) missense possibly damaging 0.95
R7693:Map6 UTSW 7 98,985,499 (GRCm39) missense possibly damaging 0.95
R7695:Map6 UTSW 7 98,985,499 (GRCm39) missense possibly damaging 0.95
R8341:Map6 UTSW 7 98,917,647 (GRCm39) missense possibly damaging 0.75
R8865:Map6 UTSW 7 98,918,192 (GRCm39) missense probably benign 0.37
R8953:Map6 UTSW 7 98,965,078 (GRCm39) missense probably damaging 1.00
R9108:Map6 UTSW 7 98,986,103 (GRCm39) missense probably damaging 1.00
R9173:Map6 UTSW 7 98,917,935 (GRCm39) missense probably damaging 1.00
R9613:Map6 UTSW 7 98,918,384 (GRCm39) missense possibly damaging 0.90
R9654:Map6 UTSW 7 98,986,166 (GRCm39) missense probably damaging 1.00
Z1176:Map6 UTSW 7 98,966,867 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TGCAGATCAGCGTGACACAC -3'
(R):5'- AAGAGCTGCTTACTGTACTCG -3'

Sequencing Primer
(F):5'- TGACACACGCAGGAAGGC -3'
(R):5'- CCTGTTGAGGGCATCTGC -3'
Posted On 2019-06-26