Incidental Mutation 'R7205:Upf1'
ID 560534
Institutional Source Beutler Lab
Gene Symbol Upf1
Ensembl Gene ENSMUSG00000058301
Gene Name UPF1 regulator of nonsense transcripts homolog (yeast)
Synonyms B430202H16Rik, Rent1, PNORF-1
MMRRC Submission 045283-MU
Accession Numbers
Essential gene? Probably essential (E-score: 0.972) question?
Stock # R7205 (G1)
Quality Score 225.009
Status Validated
Chromosome 8
Chromosomal Location 70784175-70805928 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) C to T at 70792695 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Alanine to Threonine at position 338 (A338T)
Ref Sequence ENSEMBL: ENSMUSP00000075089 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000075666] [ENSMUST00000215817]
AlphaFold Q9EPU0
Predicted Effect possibly damaging
Transcript: ENSMUST00000075666
AA Change: A338T

PolyPhen 2 Score 0.935 (Sensitivity: 0.80; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000075089
Gene: ENSMUSG00000058301
AA Change: A338T

DomainStartEndE-ValueType
low complexity region 47 67 N/A INTRINSIC
low complexity region 101 110 N/A INTRINSIC
Pfam:UPF1_Zn_bind 116 267 4.1e-78 PFAM
Pfam:ResIII 475 617 1.3e-6 PFAM
Pfam:AAA_11 476 600 4.5e-24 PFAM
Pfam:AAA_30 476 688 5.6e-13 PFAM
Pfam:AAA_19 483 559 3.8e-16 PFAM
Pfam:AAA_11 576 679 7.7e-30 PFAM
Pfam:AAA_12 686 883 3.3e-64 PFAM
low complexity region 995 1001 N/A INTRINSIC
low complexity region 1013 1028 N/A INTRINSIC
low complexity region 1066 1081 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000215817
AA Change: A338T

PolyPhen 2 Score 0.961 (Sensitivity: 0.78; Specificity: 0.95)
Meta Mutation Damage Score 0.1270 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency 97% (99/102)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein that is part of a post-splicing multiprotein complex involved in both mRNA nuclear export and mRNA surveillance. mRNA surveillance detects exported mRNAs with truncated open reading frames and initiates nonsense-mediated mRNA decay (NMD). When translation ends upstream from the last exon-exon junction, this triggers NMD to degrade mRNAs containing premature stop codons. This protein is located only in the cytoplasm. When translation ends, it interacts with the protein that is a functional homolog of yeast Upf2p to trigger mRNA decapping. Use of multiple polyadenylation sites has been noted for this gene. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Jul 2014]
PHENOTYPE: Mice homozygous for a targeted null mutation are viable in the pre-implantation period but resorb in the early post-implantation period. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 101 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca15 A T 7: 119,993,587 (GRCm39) K1269M possibly damaging Het
Adgrl2 A T 3: 148,564,585 (GRCm39) Y332N probably damaging Het
Adgrv1 C T 13: 81,627,777 (GRCm39) V3695I probably benign Het
Aldh1l1 A T 6: 90,575,257 (GRCm39) Y848F probably damaging Het
Ambra1 T C 2: 91,598,103 (GRCm39) V88A possibly damaging Het
Ankrd12 C T 17: 66,292,160 (GRCm39) R1091Q probably damaging Het
Apob T G 12: 8,055,087 (GRCm39) V1362G probably damaging Het
Arhgap17 A G 7: 122,905,661 (GRCm39) L328P probably damaging Het
Arhgap27 A C 11: 103,235,367 (GRCm39) V9G probably benign Het
Arhgap33 A T 7: 30,232,434 (GRCm39) D34E probably damaging Het
Ash1l A G 3: 88,873,259 (GRCm39) D14G probably benign Het
Atf6b T C 17: 34,872,703 (GRCm39) Y575H probably damaging Het
Bcl2l2 T G 14: 55,122,058 (GRCm39) S74A probably benign Het
Begain T C 12: 109,004,794 (GRCm39) T73A possibly damaging Het
Bicdl1 C T 5: 115,808,340 (GRCm39) R264Q probably damaging Het
Ccdc180 A G 4: 45,914,588 (GRCm39) D701G probably benign Het
Cd200r4 G T 16: 44,653,529 (GRCm39) V146L probably damaging Het
Cd226 G A 18: 89,265,322 (GRCm39) C200Y probably damaging Het
Cdcp3 T C 7: 130,879,352 (GRCm39) probably null Het
Cdhr18 T C 14: 13,866,032 (GRCm38) T286A Het
Cdk12 A G 11: 98,115,451 (GRCm39) N864S unknown Het
Cfhr4 A T 1: 139,680,788 (GRCm39) Y243* probably null Het
Clcnkb A T 4: 141,135,946 (GRCm39) L413Q probably damaging Het
Cldn10 T C 14: 119,099,255 (GRCm39) V123A possibly damaging Het
Cnn1 T A 9: 22,017,078 (GRCm39) probably null Het
Cpa5 C A 6: 30,630,829 (GRCm39) Q364K probably benign Het
Cstdc5 T C 16: 36,187,809 (GRCm39) I19V probably benign Het
Ddx11 A G 17: 66,437,766 (GRCm39) E164G probably benign Het
Dnah12 G A 14: 26,500,869 (GRCm39) probably null Het
Drc7 T A 8: 95,804,549 (GRCm39) Y855N probably damaging Het
Fam20b C A 1: 156,529,968 (GRCm39) probably null Het
Fip1l1 T A 5: 74,748,736 (GRCm39) probably null Het
Flt4 A G 11: 49,525,125 (GRCm39) D657G probably null Het
Fmo3 T A 1: 162,781,857 (GRCm39) T499S possibly damaging Het
Fyco1 C T 9: 123,651,491 (GRCm39) G1190S probably benign Het
Galnt17 C A 5: 131,335,590 (GRCm39) probably benign Het
Ggcx T C 6: 72,404,987 (GRCm39) I465T probably damaging Het
Gm7361 T A 5: 26,466,116 (GRCm39) N159K probably damaging Het
Golgb1 A G 16: 36,695,663 (GRCm39) N54S unknown Het
Grin2c G A 11: 115,141,876 (GRCm39) P848S probably damaging Het
Grina T C 15: 76,133,287 (GRCm39) V285A probably damaging Het
Gtpbp6 A G 5: 110,252,478 (GRCm39) L381P probably damaging Het
Herc2 G T 7: 55,832,388 (GRCm39) G3028V probably damaging Het
Ibsp A T 5: 104,458,297 (GRCm39) Y278F probably damaging Het
Ints4 T A 7: 97,184,433 (GRCm39) L846* probably null Het
Kif17 A G 4: 138,021,077 (GRCm39) K849E probably benign Het
Krt77 G A 15: 101,777,806 (GRCm39) P83L probably benign Het
Ky T G 9: 102,419,491 (GRCm39) D499E probably damaging Het
Lrp3 A T 7: 34,902,051 (GRCm39) M610K probably damaging Het
Lrrfip1 T A 1: 91,019,338 (GRCm39) D156E probably benign Het
Map6 C A 7: 98,918,257 (GRCm39) H343Q probably benign Het
Micu2 G T 14: 58,191,606 (GRCm39) D148E probably benign Het
Mks1 T A 11: 87,747,428 (GRCm39) S153T probably benign Het
Msantd5f3 A G 4: 73,573,157 (GRCm39) Y132C probably damaging Het
Muc6 AGGCGCAGAAACCCTGGC AGGC 7: 141,214,363 (GRCm39) probably null Het
Myh9 T C 15: 77,667,672 (GRCm39) K587R probably benign Het
Neb T C 2: 52,086,368 (GRCm39) Y5478C probably damaging Het
Nelfe G A 17: 35,069,912 (GRCm39) probably null Het
Nps T A 7: 134,870,510 (GRCm39) L11I probably damaging Het
Nsd1 A T 13: 55,394,283 (GRCm39) D731V probably damaging Het
Nup50 A G 15: 84,817,859 (GRCm39) T93A probably benign Het
Nup98 A T 7: 101,844,248 (GRCm39) F29Y unknown Het
Oprd1 A G 4: 131,841,112 (GRCm39) I282T probably damaging Het
Or4c103 T C 2: 88,513,767 (GRCm39) H103R possibly damaging Het
Or5p50 T C 7: 107,421,782 (GRCm39) N298S probably benign Het
Or6b3 A T 1: 92,439,573 (GRCm39) M59K probably benign Het
Or6d12 A G 6: 116,492,936 (GRCm39) Y66C probably damaging Het
Osbp2 T C 11: 3,662,134 (GRCm39) I240V probably damaging Het
Otub2 C A 12: 103,359,163 (GRCm39) P84Q probably benign Het
Parp9 A T 16: 35,777,360 (GRCm39) I435F probably benign Het
Pcdh18 C T 3: 49,709,923 (GRCm39) R464H probably benign Het
Pcsk6 G T 7: 65,675,156 (GRCm39) probably null Het
Ptgs2 G A 1: 149,978,512 (GRCm39) R208Q probably benign Het
Rab11b G A 17: 33,968,841 (GRCm39) R51C probably damaging Het
Rad1 A G 15: 10,493,343 (GRCm39) I257V probably benign Het
Rbms3 C T 9: 116,415,085 (GRCm39) probably null Het
Rxfp2 A T 5: 149,983,364 (GRCm39) I300L probably benign Het
Rxfp2 C A 5: 149,983,368 (GRCm39) T301K probably benign Het
Sars2 G T 7: 28,443,733 (GRCm39) A112S probably benign Het
Scn10a T C 9: 119,442,616 (GRCm39) D1543G probably damaging Het
Serpinb1b A G 13: 33,271,406 (GRCm39) H59R probably benign Het
Sgsm2 T A 11: 74,745,319 (GRCm39) D661V possibly damaging Het
Smad6 C A 9: 63,927,688 (GRCm39) V207L probably damaging Het
Son TCCCCCAGCCGCAGGAGCCGAACCCCCAGCCGCAGGAGCAGAACCCCCAGCCGCAGGAGCCGAACCCCCAGCCGCAGGAGCCGAACCCCCAGCCGCAGGAGCCGAACCCCCAGCCG TCCCCCAGCCGCAGGAGCCGAACCCCCAGCCGCAGGAGCCGAACCCCCAGCCGCAGGAGCCGAACCCCCAGCCG 16: 91,457,183 (GRCm39) probably benign Het
Spata31h1 A T 10: 82,125,161 (GRCm39) D2616E probably benign Het
Tenm2 C T 11: 35,939,956 (GRCm39) R1390Q probably damaging Het
Tmem132a T A 19: 10,844,295 (GRCm39) Q101L probably damaging Het
Tmem151a A G 19: 5,132,801 (GRCm39) V135A probably damaging Het
Trappc10 T C 10: 78,046,262 (GRCm39) K443E probably damaging Het
Trrap A T 5: 144,779,517 (GRCm39) N3161I possibly damaging Het
Tspan32 G T 7: 142,558,863 (GRCm39) R6L possibly damaging Het
Tut7 C G 13: 59,936,364 (GRCm39) D1246H probably damaging Het
Ugt2a2 T C 5: 87,608,468 (GRCm39) D457G possibly damaging Het
Ulk2 A T 11: 61,725,657 (GRCm39) S140T possibly damaging Het
Usp43 C T 11: 67,774,110 (GRCm39) R460Q probably null Het
Uxs1 A G 1: 43,856,118 (GRCm39) probably benign Het
Vmn1r59 A G 7: 5,457,725 (GRCm39) C12R probably damaging Het
Wdr64 A G 1: 175,617,499 (GRCm39) D693G probably benign Het
Wnk1 A T 6: 119,920,839 (GRCm39) probably null Het
Wnt2 G T 6: 18,028,046 (GRCm39) R63S probably benign Het
Zfp418 A T 7: 7,184,562 (GRCm39) Q175L probably benign Het
Other mutations in Upf1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01113:Upf1 APN 8 70,790,934 (GRCm39) missense probably benign
IGL01890:Upf1 APN 8 70,786,880 (GRCm39) missense possibly damaging 0.94
IGL02534:Upf1 APN 8 70,788,302 (GRCm39) critical splice donor site probably null
IGL03142:Upf1 APN 8 70,785,977 (GRCm39) missense probably benign 0.04
IGL03151:Upf1 APN 8 70,788,037 (GRCm39) missense probably damaging 0.98
Nanosphere UTSW 8 70,796,912 (GRCm39) missense probably benign 0.01
Particulate UTSW 8 70,789,675 (GRCm39) missense probably damaging 0.96
R0270:Upf1 UTSW 8 70,788,295 (GRCm39) splice site probably benign
R0477:Upf1 UTSW 8 70,786,730 (GRCm39) missense probably benign
R0755:Upf1 UTSW 8 70,786,779 (GRCm39) missense probably benign 0.01
R1018:Upf1 UTSW 8 70,791,556 (GRCm39) missense possibly damaging 0.85
R1067:Upf1 UTSW 8 70,791,053 (GRCm39) missense probably damaging 0.98
R1445:Upf1 UTSW 8 70,794,174 (GRCm39) missense probably benign 0.00
R1458:Upf1 UTSW 8 70,796,904 (GRCm39) missense probably benign 0.00
R1511:Upf1 UTSW 8 70,791,155 (GRCm39) missense probably damaging 0.99
R1552:Upf1 UTSW 8 70,785,709 (GRCm39) nonsense probably null
R1560:Upf1 UTSW 8 70,791,092 (GRCm39) missense probably damaging 1.00
R1562:Upf1 UTSW 8 70,796,017 (GRCm39) nonsense probably null
R2082:Upf1 UTSW 8 70,794,222 (GRCm39) missense probably damaging 1.00
R2143:Upf1 UTSW 8 70,792,004 (GRCm39) missense probably null 1.00
R2423:Upf1 UTSW 8 70,791,110 (GRCm39) missense probably damaging 1.00
R2425:Upf1 UTSW 8 70,791,110 (GRCm39) missense probably damaging 1.00
R3031:Upf1 UTSW 8 70,791,110 (GRCm39) missense probably damaging 1.00
R3032:Upf1 UTSW 8 70,791,110 (GRCm39) missense probably damaging 1.00
R3123:Upf1 UTSW 8 70,790,133 (GRCm39) splice site probably benign
R3508:Upf1 UTSW 8 70,791,110 (GRCm39) missense probably damaging 1.00
R3747:Upf1 UTSW 8 70,786,000 (GRCm39) missense possibly damaging 0.75
R3748:Upf1 UTSW 8 70,786,000 (GRCm39) missense possibly damaging 0.75
R3750:Upf1 UTSW 8 70,786,000 (GRCm39) missense possibly damaging 0.75
R3754:Upf1 UTSW 8 70,792,464 (GRCm39) missense probably benign 0.30
R3964:Upf1 UTSW 8 70,791,110 (GRCm39) missense probably damaging 1.00
R3965:Upf1 UTSW 8 70,791,110 (GRCm39) missense probably damaging 1.00
R4152:Upf1 UTSW 8 70,791,110 (GRCm39) missense probably damaging 1.00
R4505:Upf1 UTSW 8 70,790,216 (GRCm39) missense probably damaging 1.00
R4506:Upf1 UTSW 8 70,790,216 (GRCm39) missense probably damaging 1.00
R4838:Upf1 UTSW 8 70,792,018 (GRCm39) missense probably benign 0.03
R5001:Upf1 UTSW 8 70,787,350 (GRCm39) missense probably damaging 1.00
R5715:Upf1 UTSW 8 70,805,628 (GRCm39) missense probably damaging 0.96
R5748:Upf1 UTSW 8 70,791,167 (GRCm39) missense probably damaging 1.00
R5856:Upf1 UTSW 8 70,787,412 (GRCm39) critical splice acceptor site probably null
R5930:Upf1 UTSW 8 70,796,912 (GRCm39) missense probably benign 0.01
R6010:Upf1 UTSW 8 70,789,675 (GRCm39) missense probably damaging 0.96
R6056:Upf1 UTSW 8 70,785,687 (GRCm39) missense probably damaging 0.98
R6870:Upf1 UTSW 8 70,794,211 (GRCm39) missense probably benign 0.11
R7385:Upf1 UTSW 8 70,793,268 (GRCm39) missense probably damaging 1.00
R7464:Upf1 UTSW 8 70,786,073 (GRCm39) missense probably benign
R7759:Upf1 UTSW 8 70,786,730 (GRCm39) missense probably benign
R7783:Upf1 UTSW 8 70,805,508 (GRCm39) missense probably benign 0.11
R8079:Upf1 UTSW 8 70,791,534 (GRCm39) critical splice donor site probably null
R8192:Upf1 UTSW 8 70,793,294 (GRCm39) missense probably benign 0.03
R8544:Upf1 UTSW 8 70,789,702 (GRCm39) missense probably damaging 1.00
R8738:Upf1 UTSW 8 70,785,973 (GRCm39) missense probably benign 0.06
R8738:Upf1 UTSW 8 70,785,972 (GRCm39) missense probably benign 0.01
R8826:Upf1 UTSW 8 70,790,930 (GRCm39) missense probably benign
R8876:Upf1 UTSW 8 70,796,918 (GRCm39) missense possibly damaging 0.92
R8906:Upf1 UTSW 8 70,786,815 (GRCm39) nonsense probably null
R8911:Upf1 UTSW 8 70,791,087 (GRCm39) missense possibly damaging 0.53
R9163:Upf1 UTSW 8 70,792,674 (GRCm39) missense probably benign
R9425:Upf1 UTSW 8 70,792,003 (GRCm39) missense probably benign 0.06
Predicted Primers PCR Primer
(F):5'- AGTTAGCACTTTCAAGAGGGC -3'
(R):5'- GGCTCTCTACAAAGCTTGCTG -3'

Sequencing Primer
(F):5'- ACTTTCAAGAGGGCGTGGC -3'
(R):5'- CAGATGCTGGAGTTCCTGGC -3'
Posted On 2019-06-26