Incidental Mutation 'R7205:Nsd1'
ID560558
Institutional Source Beutler Lab
Gene Symbol Nsd1
Ensembl Gene ENSMUSG00000021488
Gene Namenuclear receptor-binding SET-domain protein 1
SynonymsKMT3B
MMRRC Submission
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R7205 (G1)
Quality Score225.009
Status Validated
Chromosome13
Chromosomal Location55209782-55318325 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 55246470 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Valine at position 731 (D731V)
Ref Sequence ENSEMBL: ENSMUSP00000097089 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000099490] [ENSMUST00000224973]
Predicted Effect probably damaging
Transcript: ENSMUST00000099490
AA Change: D731V

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000097089
Gene: ENSMUSG00000021488
AA Change: D731V

DomainStartEndE-ValueType
low complexity region 177 187 N/A INTRINSIC
low complexity region 281 289 N/A INTRINSIC
PWWP 322 388 1.97e-3 SMART
low complexity region 635 644 N/A INTRINSIC
low complexity region 980 1000 N/A INTRINSIC
low complexity region 1296 1309 N/A INTRINSIC
PHD 1546 1588 4.25e-8 SMART
PHD 1593 1640 3.79e-5 SMART
RING 1594 1639 1.08e-1 SMART
PHD 1641 1694 1.09e1 SMART
PHD 1710 1750 1.02e-10 SMART
PWWP 1755 1817 8.87e-29 SMART
AWS 1891 1942 3.02e-22 SMART
SET 1943 2066 1e-45 SMART
PostSET 2067 2083 3.99e-3 SMART
PHD 2121 2164 1.08e-9 SMART
low complexity region 2224 2237 N/A INTRINSIC
low complexity region 2276 2286 N/A INTRINSIC
low complexity region 2335 2356 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000224973
AA Change: D628V

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency 97% (99/102)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein containing a SET domain, 2 LXXLL motifs, 3 nuclear translocation signals (NLSs), 4 plant homeodomain (PHD) finger regions, and a proline-rich region. The encoded protein enhances androgen receptor (AR) transactivation, and this enhancement can be increased further in the presence of other androgen receptor associated coregulators. This protein may act as a nucleus-localized, basic transcriptional factor and also as a bifunctional transcriptional regulator. Mutations of this gene have been associated with Sotos syndrome and Weaver syndrome. One version of childhood acute myeloid leukemia is the result of a cryptic translocation with the breakpoints occurring within nuclear receptor-binding Su-var, enhancer of zeste, and trithorax domain protein 1 on chromosome 5 and nucleoporin, 98-kd on chromosome 11. Two transcript variants encoding distinct isoforms have been identified for this gene. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygotes for targeted null mutations exhibit excess apoptosis and retarded growth, fail to complete gastrulation, and are resorbed by embryonic day 10. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 101 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4932415D10Rik A T 10: 82,289,327 D2616E probably benign Het
5430419D17Rik T C 7: 131,277,623 probably null Het
Abca15 A T 7: 120,394,364 K1269M possibly damaging Het
Adgrl2 A T 3: 148,858,949 Y332N probably damaging Het
Adgrv1 C T 13: 81,479,658 V3695I probably benign Het
Aldh1l1 A T 6: 90,598,275 Y848F probably damaging Het
Ambra1 T C 2: 91,767,758 V88A possibly damaging Het
Ankrd12 C T 17: 65,985,165 R1091Q probably damaging Het
Apob T G 12: 8,005,087 V1362G probably damaging Het
Arhgap17 A G 7: 123,306,438 L328P probably damaging Het
Arhgap27 A C 11: 103,344,541 V9G probably benign Het
Arhgap33 A T 7: 30,533,009 D34E probably damaging Het
Ash1l A G 3: 88,965,952 D14G probably benign Het
Atf6b T C 17: 34,653,729 Y575H probably damaging Het
BC100530 T C 16: 36,367,447 I19V probably benign Het
Bcl2l2 T G 14: 54,884,601 S74A probably benign Het
Begain T C 12: 109,038,868 T73A possibly damaging Het
Bicdl1 C T 5: 115,670,281 R264Q probably damaging Het
Ccdc180 A G 4: 45,914,588 D701G probably benign Het
Cd200r4 G T 16: 44,833,166 V146L probably damaging Het
Cd226 G A 18: 89,247,198 C200Y probably damaging Het
Cdk12 A G 11: 98,224,625 N864S unknown Het
Clcnkb A T 4: 141,408,635 L413Q probably damaging Het
Cldn10 T C 14: 118,861,843 V123A possibly damaging Het
Cnn1 T A 9: 22,105,782 probably null Het
Cpa5 C A 6: 30,630,830 Q364K probably benign Het
Ddx11 A G 17: 66,130,771 E164G probably benign Het
Dnah12 G A 14: 26,778,912 probably null Het
Drc7 T A 8: 95,077,921 Y855N probably damaging Het
Fam20b C A 1: 156,702,398 probably null Het
Fip1l1 T A 5: 74,588,075 probably null Het
Flt4 A G 11: 49,634,298 D657G probably null Het
Fmo3 T A 1: 162,954,288 T499S possibly damaging Het
Fyco1 C T 9: 123,822,426 G1190S probably benign Het
Galnt17 C A 5: 131,306,752 probably benign Het
Ggcx T C 6: 72,428,004 I465T probably damaging Het
Gm11238 A G 4: 73,654,920 Y132C probably damaging Het
Gm281 T C 14: 13,866,032 T286A Het
Gm4788 A T 1: 139,753,050 Y243* probably null Het
Gm7361 T A 5: 26,261,118 N159K probably damaging Het
Golgb1 A G 16: 36,875,301 N54S unknown Het
Grin2c G A 11: 115,251,050 P848S probably damaging Het
Grina T C 15: 76,249,087 V285A probably damaging Het
Gtpbp6 A G 5: 110,104,612 L381P probably damaging Het
Herc2 G T 7: 56,182,640 G3028V probably damaging Het
Ibsp A T 5: 104,310,431 Y278F probably damaging Het
Ints4 T A 7: 97,535,226 L846* probably null Het
Kif17 A G 4: 138,293,766 K849E probably benign Het
Krt77 G A 15: 101,869,371 P83L probably benign Het
Ky T G 9: 102,542,292 D499E probably damaging Het
Lrp3 A T 7: 35,202,626 M610K probably damaging Het
Lrrfip1 T A 1: 91,091,616 D156E probably benign Het
Map6 C A 7: 99,269,050 H343Q probably benign Het
Micu2 G T 14: 57,954,149 D148E probably benign Het
Mks1 T A 11: 87,856,602 S153T probably benign Het
Muc6 AGGCGCAGAAACCCTGGC AGGC 7: 141,634,450 probably null Het
Myh9 T C 15: 77,783,472 K587R probably benign Het
Neb T C 2: 52,196,356 Y5478C probably damaging Het
Nelfe G A 17: 34,850,936 probably null Het
Nps T A 7: 135,268,781 L11I probably damaging Het
Nup50 A G 15: 84,933,658 T93A probably benign Het
Nup98 A T 7: 102,195,041 F29Y unknown Het
Olfr1195 T C 2: 88,683,423 H103R possibly damaging Het
Olfr1414 A T 1: 92,511,851 M59K probably benign Het
Olfr212 A G 6: 116,515,975 Y66C probably damaging Het
Olfr469 T C 7: 107,822,575 N298S probably benign Het
Oprd1 A G 4: 132,113,801 I282T probably damaging Het
Osbp2 T C 11: 3,712,134 I240V probably damaging Het
Otub2 C A 12: 103,392,904 P84Q probably benign Het
Parp9 A T 16: 35,956,990 I435F probably benign Het
Pcdh18 C T 3: 49,755,474 R464H probably benign Het
Pcsk6 G T 7: 66,025,408 probably null Het
Ptgs2 G A 1: 150,102,761 R208Q probably benign Het
Rab11b G A 17: 33,749,867 R51C probably damaging Het
Rad1 A G 15: 10,493,257 I257V probably benign Het
Rbms3 C T 9: 116,586,017 probably null Het
Rxfp2 A T 5: 150,059,899 I300L probably benign Het
Rxfp2 C A 5: 150,059,903 T301K probably benign Het
Sars2 G T 7: 28,744,308 A112S probably benign Het
Scn10a T C 9: 119,613,550 D1543G probably damaging Het
Serpinb1b A G 13: 33,087,423 H59R probably benign Het
Sgsm2 T A 11: 74,854,493 D661V possibly damaging Het
Smad6 C A 9: 64,020,406 V207L probably damaging Het
Son TCCCCCAGCCGCAGGAGCCGAACCCCCAGCCGCAGGAGCAGAACCCCCAGCCGCAGGAGCCGAACCCCCAGCCGCAGGAGCCGAACCCCCAGCCGCAGGAGCCGAACCCCCAGCCG TCCCCCAGCCGCAGGAGCCGAACCCCCAGCCGCAGGAGCCGAACCCCCAGCCGCAGGAGCCGAACCCCCAGCCG 16: 91,660,295 probably benign Het
Tenm2 C T 11: 36,049,129 R1390Q probably damaging Het
Tmem132a T A 19: 10,866,931 Q101L probably damaging Het
Tmem151a A G 19: 5,082,773 V135A probably damaging Het
Trappc10 T C 10: 78,210,428 K443E probably damaging Het
Trrap A T 5: 144,842,707 N3161I possibly damaging Het
Tspan32 G T 7: 143,005,126 R6L possibly damaging Het
Ugt2a2 T C 5: 87,460,609 D457G possibly damaging Het
Ulk2 A T 11: 61,834,831 S140T possibly damaging Het
Upf1 C T 8: 70,340,045 A338T possibly damaging Het
Usp43 C T 11: 67,883,284 R460Q probably null Het
Uxs1 A G 1: 43,816,958 probably benign Het
Vmn1r59 A G 7: 5,454,726 C12R probably damaging Het
Wdr64 A G 1: 175,789,933 D693G probably benign Het
Wnk1 A T 6: 119,943,878 probably null Het
Wnt2 G T 6: 18,028,047 R63S probably benign Het
Zcchc6 C G 13: 59,788,550 D1246H probably damaging Het
Zfp418 A T 7: 7,181,563 Q175L probably benign Het
Other mutations in Nsd1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00777:Nsd1 APN 13 55238735 missense probably damaging 1.00
IGL01060:Nsd1 APN 13 55263429 missense probably damaging 1.00
IGL01125:Nsd1 APN 13 55245617 missense probably damaging 1.00
IGL01746:Nsd1 APN 13 55276515 splice site probably null
IGL02437:Nsd1 APN 13 55313441 missense probably damaging 1.00
IGL02530:Nsd1 APN 13 55302833 splice site probably benign
IGL02557:Nsd1 APN 13 55312448 missense probably damaging 1.00
IGL02572:Nsd1 APN 13 55296130 missense probably damaging 1.00
IGL02665:Nsd1 APN 13 55296183 missense probably damaging 1.00
IGL02870:Nsd1 APN 13 55313603 missense probably benign 0.06
IGL03181:Nsd1 APN 13 55247045 missense probably damaging 1.00
Amanuensis UTSW 13 55261626 nonsense probably null
scribe UTSW 13 55291236 missense probably damaging 1.00
PIT4480001:Nsd1 UTSW 13 55213918 missense probably benign 0.11
R0316:Nsd1 UTSW 13 55213771 missense probably damaging 0.98
R0519:Nsd1 UTSW 13 55312835 missense probably benign 0.04
R0542:Nsd1 UTSW 13 55260458 missense possibly damaging 0.93
R0563:Nsd1 UTSW 13 55246578 missense possibly damaging 0.48
R0652:Nsd1 UTSW 13 55247586 missense possibly damaging 0.92
R0906:Nsd1 UTSW 13 55277590 missense probably benign 0.30
R1560:Nsd1 UTSW 13 55246720 nonsense probably null
R1572:Nsd1 UTSW 13 55246969 missense probably damaging 0.98
R1693:Nsd1 UTSW 13 55247261 missense probably benign
R1697:Nsd1 UTSW 13 55214059 critical splice acceptor site probably null
R1720:Nsd1 UTSW 13 55246898 missense probably damaging 0.98
R1829:Nsd1 UTSW 13 55246369 missense probably damaging 1.00
R1834:Nsd1 UTSW 13 55313351 missense possibly damaging 0.52
R1842:Nsd1 UTSW 13 55246445 missense probably damaging 1.00
R1880:Nsd1 UTSW 13 55213793 missense probably damaging 0.99
R2022:Nsd1 UTSW 13 55213279 missense probably damaging 0.99
R2075:Nsd1 UTSW 13 55310500 missense possibly damaging 0.74
R2143:Nsd1 UTSW 13 55260397 missense probably damaging 1.00
R2151:Nsd1 UTSW 13 55291236 missense probably damaging 1.00
R2316:Nsd1 UTSW 13 55233966 missense probably damaging 1.00
R2359:Nsd1 UTSW 13 55213711 missense possibly damaging 0.90
R2361:Nsd1 UTSW 13 55213711 missense possibly damaging 0.90
R2656:Nsd1 UTSW 13 55246868 missense probably damaging 1.00
R2849:Nsd1 UTSW 13 55213692 missense probably damaging 0.99
R3237:Nsd1 UTSW 13 55312888 missense possibly damaging 0.92
R3772:Nsd1 UTSW 13 55246673 missense probably benign 0.00
R3773:Nsd1 UTSW 13 55246673 missense probably benign 0.00
R3849:Nsd1 UTSW 13 55246691 missense probably benign 0.00
R3951:Nsd1 UTSW 13 55268454 missense probably benign 0.05
R4036:Nsd1 UTSW 13 55213711 missense possibly damaging 0.90
R4073:Nsd1 UTSW 13 55247728 missense probably benign 0.28
R4080:Nsd1 UTSW 13 55301809 missense probably damaging 0.96
R4226:Nsd1 UTSW 13 55260401 missense probably damaging 1.00
R4485:Nsd1 UTSW 13 55245621 missense probably benign
R4703:Nsd1 UTSW 13 55214063 missense probably damaging 1.00
R4853:Nsd1 UTSW 13 55268504 missense probably benign 0.30
R4915:Nsd1 UTSW 13 55247868 missense possibly damaging 0.65
R4915:Nsd1 UTSW 13 55276528 missense probably benign 0.00
R5264:Nsd1 UTSW 13 55247346 missense possibly damaging 0.49
R5348:Nsd1 UTSW 13 55312334 missense probably benign 0.00
R5473:Nsd1 UTSW 13 55247772 missense probably damaging 1.00
R5498:Nsd1 UTSW 13 55213302 nonsense probably null
R5503:Nsd1 UTSW 13 55245939 missense probably damaging 1.00
R5511:Nsd1 UTSW 13 55312730 missense probably benign 0.00
R5683:Nsd1 UTSW 13 55246148 missense probably benign 0.00
R5778:Nsd1 UTSW 13 55306979 missense probably damaging 1.00
R5793:Nsd1 UTSW 13 55248006 missense probably benign
R5922:Nsd1 UTSW 13 55247475 missense probably benign 0.01
R5956:Nsd1 UTSW 13 55263404 missense probably damaging 1.00
R6053:Nsd1 UTSW 13 55293609 missense probably damaging 1.00
R6141:Nsd1 UTSW 13 55291284 missense probably damaging 1.00
R6158:Nsd1 UTSW 13 55245621 missense probably benign
R6224:Nsd1 UTSW 13 55313132 missense possibly damaging 0.85
R6396:Nsd1 UTSW 13 55238789 missense probably damaging 1.00
R6598:Nsd1 UTSW 13 55293702 missense possibly damaging 0.94
R7170:Nsd1 UTSW 13 55261626 nonsense probably null
R7215:Nsd1 UTSW 13 55247641 missense probably benign 0.00
R7337:Nsd1 UTSW 13 55246209 missense probably damaging 1.00
R7432:Nsd1 UTSW 13 55213374 missense probably benign
R7638:Nsd1 UTSW 13 55312328 missense probably benign 0.01
R7647:Nsd1 UTSW 13 55299835 missense probably damaging 0.96
R7658:Nsd1 UTSW 13 55277639 missense probably damaging 1.00
R7884:Nsd1 UTSW 13 55313255 missense probably damaging 0.99
R8032:Nsd1 UTSW 13 55310383 missense probably damaging 1.00
R8113:Nsd1 UTSW 13 55245621 missense probably benign
R8152:Nsd1 UTSW 13 55310367 missense possibly damaging 0.49
R8183:Nsd1 UTSW 13 55312373 missense probably damaging 1.00
Z1088:Nsd1 UTSW 13 55213848 missense possibly damaging 0.83
Z1176:Nsd1 UTSW 13 55245525 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AAAACAGAGAATGCTTTATCGGTGC -3'
(R):5'- GCTGAGGTTTCTGCAACAGC -3'

Sequencing Primer
(F):5'- GCTTTATCGGTGCACAAAAATG -3'
(R):5'- TTTCTGCAACAGCTGGGC -3'
Posted On2019-06-26