Incidental Mutation 'R7205:Adgrv1'
ID560560
Institutional Source Beutler Lab
Gene Symbol Adgrv1
Ensembl Gene ENSMUSG00000069170
Gene Nameadhesion G protein-coupled receptor V1
SynonymsMass1, Mgr1, VLGR1, Gpr98
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R7205 (G1)
Quality Score225.009
Status Validated
Chromosome13
Chromosomal Location81095068-81633154 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 81479658 bp
ZygosityHeterozygous
Amino Acid Change Valine to Isoleucine at position 3695 (V3695I)
Ref Sequence ENSEMBL: ENSMUSP00000093245 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000095585]
Predicted Effect probably benign
Transcript: ENSMUST00000095585
AA Change: V3695I

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
SMART Domains Protein: ENSMUSP00000093245
Gene: ENSMUSG00000069170
AA Change: V3695I

DomainStartEndE-ValueType
Calx_beta 20 116 1.53e-1 SMART
Calx_beta 132 236 1.58e-2 SMART
Calx_beta 251 362 2.33e-2 SMART
Pfam:Calx-beta 380 489 1.1e-3 PFAM
Pfam:Calx-beta 507 616 2.5e-2 PFAM
Pfam:Calx-beta 667 747 9.1e-4 PFAM
Calx_beta 764 862 1.55e-1 SMART
Calx_beta 877 980 1.07e-1 SMART
Calx_beta 994 1094 6.45e-5 SMART
Pfam:Calx-beta 1108 1208 7.4e-4 PFAM
Pfam:Laminin_G_3 1331 1492 4.4e-24 PFAM
Pfam:Calx-beta 1498 1542 6.5e-3 PFAM
Pfam:Calx-beta 1557 1662 1e-6 PFAM
Calx_beta 1706 1805 1.34e-11 SMART
Calx_beta 1846 1948 1.04e-2 SMART
Calx_beta 1962 2075 1.59e-3 SMART
Calx_beta 2103 2202 1.59e-4 SMART
Calx_beta 2218 2320 1.74e-3 SMART
Pfam:Calx-beta 2467 2539 2.1e-4 PFAM
Calx_beta 2576 2672 1.24e-6 SMART
Calx_beta 2687 2786 1.12e-1 SMART
Calx_beta 2810 2921 2.21e-2 SMART
Calx_beta 2945 3044 6.69e-12 SMART
Pfam:Calx-beta 3063 3168 1.2e-5 PFAM
Pfam:Calx-beta 3198 3252 1.2e-1 PFAM
Pfam:EPTP 3391 3434 2.8e-10 PFAM
Pfam:Calx-beta 3577 3623 6.5e-8 PFAM
Pfam:Calx-beta 3637 3737 6e-4 PFAM
Pfam:Calx-beta 3781 3872 6.9e-3 PFAM
Calx_beta 3919 4003 1.18e-2 SMART
Calx_beta 4017 4120 5.44e-2 SMART
Pfam:Calx-beta 4193 4236 2.3e-2 PFAM
Calx_beta 4251 4351 1.43e-20 SMART
Calx_beta 4384 4484 9.46e-3 SMART
Pfam:Calx-beta 4498 4608 2e-2 PFAM
Pfam:Calx-beta 4659 4729 5.1e-2 PFAM
Calx_beta 4989 5089 5.7e-6 SMART
Pfam:Calx-beta 5229 5326 1.9e-6 PFAM
Pfam:Calx-beta 5489 5592 7.2e-5 PFAM
low complexity region 5637 5648 N/A INTRINSIC
GPS 5845 5895 9.48e-3 SMART
Pfam:7tm_2 5902 6141 2.3e-16 PFAM
low complexity region 6227 6240 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency 97% (99/102)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the G-protein coupled receptor superfamily. The encoded protein contains a 7-transmembrane receptor domain, binds calcium and is expressed in the central nervous system. Mutations in this gene are associated with Usher syndrome 2 and familial febrile seizures. Several alternatively spliced transcripts have been described. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygotes for a spontaneous and a targeted mutation exhibit high sensitivity to audiogenic seizures. Targeted mutant mice lack the ankle links that connect growing stereocilia in the developing cochlear hair cells. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 101 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4932415D10Rik A T 10: 82,289,327 D2616E probably benign Het
5430419D17Rik T C 7: 131,277,623 probably null Het
Abca15 A T 7: 120,394,364 K1269M possibly damaging Het
Adgrl2 A T 3: 148,858,949 Y332N probably damaging Het
Aldh1l1 A T 6: 90,598,275 Y848F probably damaging Het
Ambra1 T C 2: 91,767,758 V88A possibly damaging Het
Ankrd12 C T 17: 65,985,165 R1091Q probably damaging Het
Apob T G 12: 8,005,087 V1362G probably damaging Het
Arhgap17 A G 7: 123,306,438 L328P probably damaging Het
Arhgap27 A C 11: 103,344,541 V9G probably benign Het
Arhgap33 A T 7: 30,533,009 D34E probably damaging Het
Ash1l A G 3: 88,965,952 D14G probably benign Het
Atf6b T C 17: 34,653,729 Y575H probably damaging Het
BC100530 T C 16: 36,367,447 I19V probably benign Het
Bcl2l2 T G 14: 54,884,601 S74A probably benign Het
Begain T C 12: 109,038,868 T73A possibly damaging Het
Bicdl1 C T 5: 115,670,281 R264Q probably damaging Het
Ccdc180 A G 4: 45,914,588 D701G probably benign Het
Cd200r4 G T 16: 44,833,166 V146L probably damaging Het
Cd226 G A 18: 89,247,198 C200Y probably damaging Het
Cdk12 A G 11: 98,224,625 N864S unknown Het
Clcnkb A T 4: 141,408,635 L413Q probably damaging Het
Cldn10 T C 14: 118,861,843 V123A possibly damaging Het
Cnn1 T A 9: 22,105,782 probably null Het
Cpa5 C A 6: 30,630,830 Q364K probably benign Het
Ddx11 A G 17: 66,130,771 E164G probably benign Het
Dnah12 G A 14: 26,778,912 probably null Het
Drc7 T A 8: 95,077,921 Y855N probably damaging Het
Fam20b C A 1: 156,702,398 probably null Het
Fip1l1 T A 5: 74,588,075 probably null Het
Flt4 A G 11: 49,634,298 D657G probably null Het
Fmo3 T A 1: 162,954,288 T499S possibly damaging Het
Fyco1 C T 9: 123,822,426 G1190S probably benign Het
Galnt17 C A 5: 131,306,752 probably benign Het
Ggcx T C 6: 72,428,004 I465T probably damaging Het
Gm11238 A G 4: 73,654,920 Y132C probably damaging Het
Gm281 T C 14: 13,866,032 T286A Het
Gm4788 A T 1: 139,753,050 Y243* probably null Het
Gm7361 T A 5: 26,261,118 N159K probably damaging Het
Golgb1 A G 16: 36,875,301 N54S unknown Het
Grin2c G A 11: 115,251,050 P848S probably damaging Het
Grina T C 15: 76,249,087 V285A probably damaging Het
Gtpbp6 A G 5: 110,104,612 L381P probably damaging Het
Herc2 G T 7: 56,182,640 G3028V probably damaging Het
Ibsp A T 5: 104,310,431 Y278F probably damaging Het
Ints4 T A 7: 97,535,226 L846* probably null Het
Kif17 A G 4: 138,293,766 K849E probably benign Het
Krt77 G A 15: 101,869,371 P83L probably benign Het
Ky T G 9: 102,542,292 D499E probably damaging Het
Lrp3 A T 7: 35,202,626 M610K probably damaging Het
Lrrfip1 T A 1: 91,091,616 D156E probably benign Het
Map6 C A 7: 99,269,050 H343Q probably benign Het
Micu2 G T 14: 57,954,149 D148E probably benign Het
Mks1 T A 11: 87,856,602 S153T probably benign Het
Muc6 AGGCGCAGAAACCCTGGC AGGC 7: 141,634,450 probably null Het
Myh9 T C 15: 77,783,472 K587R probably benign Het
Neb T C 2: 52,196,356 Y5478C probably damaging Het
Nelfe G A 17: 34,850,936 probably null Het
Nps T A 7: 135,268,781 L11I probably damaging Het
Nsd1 A T 13: 55,246,470 D731V probably damaging Het
Nup50 A G 15: 84,933,658 T93A probably benign Het
Nup98 A T 7: 102,195,041 F29Y unknown Het
Olfr1195 T C 2: 88,683,423 H103R possibly damaging Het
Olfr1414 A T 1: 92,511,851 M59K probably benign Het
Olfr212 A G 6: 116,515,975 Y66C probably damaging Het
Olfr469 T C 7: 107,822,575 N298S probably benign Het
Oprd1 A G 4: 132,113,801 I282T probably damaging Het
Osbp2 T C 11: 3,712,134 I240V probably damaging Het
Otub2 C A 12: 103,392,904 P84Q probably benign Het
Parp9 A T 16: 35,956,990 I435F probably benign Het
Pcdh18 C T 3: 49,755,474 R464H probably benign Het
Pcsk6 G T 7: 66,025,408 probably null Het
Ptgs2 G A 1: 150,102,761 R208Q probably benign Het
Rab11b G A 17: 33,749,867 R51C probably damaging Het
Rad1 A G 15: 10,493,257 I257V probably benign Het
Rbms3 C T 9: 116,586,017 probably null Het
Rxfp2 A T 5: 150,059,899 I300L probably benign Het
Rxfp2 C A 5: 150,059,903 T301K probably benign Het
Sars2 G T 7: 28,744,308 A112S probably benign Het
Scn10a T C 9: 119,613,550 D1543G probably damaging Het
Serpinb1b A G 13: 33,087,423 H59R probably benign Het
Sgsm2 T A 11: 74,854,493 D661V possibly damaging Het
Smad6 C A 9: 64,020,406 V207L probably damaging Het
Son TCCCCCAGCCGCAGGAGCCGAACCCCCAGCCGCAGGAGCAGAACCCCCAGCCGCAGGAGCCGAACCCCCAGCCGCAGGAGCCGAACCCCCAGCCGCAGGAGCCGAACCCCCAGCCG TCCCCCAGCCGCAGGAGCCGAACCCCCAGCCGCAGGAGCCGAACCCCCAGCCGCAGGAGCCGAACCCCCAGCCG 16: 91,660,295 probably benign Het
Tenm2 C T 11: 36,049,129 R1390Q probably damaging Het
Tmem132a T A 19: 10,866,931 Q101L probably damaging Het
Tmem151a A G 19: 5,082,773 V135A probably damaging Het
Trappc10 T C 10: 78,210,428 K443E probably damaging Het
Trrap A T 5: 144,842,707 N3161I possibly damaging Het
Tspan32 G T 7: 143,005,126 R6L possibly damaging Het
Ugt2a2 T C 5: 87,460,609 D457G possibly damaging Het
Ulk2 A T 11: 61,834,831 S140T possibly damaging Het
Upf1 C T 8: 70,340,045 A338T possibly damaging Het
Usp43 C T 11: 67,883,284 R460Q probably null Het
Uxs1 A G 1: 43,816,958 probably benign Het
Vmn1r59 A G 7: 5,454,726 C12R probably damaging Het
Wdr64 A G 1: 175,789,933 D693G probably benign Het
Wnk1 A T 6: 119,943,878 probably null Het
Wnt2 G T 6: 18,028,047 R63S probably benign Het
Zcchc6 C G 13: 59,788,550 D1246H probably damaging Het
Zfp418 A T 7: 7,181,563 Q175L probably benign Het
Other mutations in Adgrv1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00090:Adgrv1 APN 13 81405408 critical splice acceptor site probably null
IGL00090:Adgrv1 APN 13 81578101 missense probably damaging 1.00
IGL00091:Adgrv1 APN 13 81578101 missense probably damaging 1.00
IGL00332:Adgrv1 APN 13 81472877 splice site probably benign
IGL00471:Adgrv1 APN 13 81509542 missense probably damaging 0.99
IGL00476:Adgrv1 APN 13 81489074 missense probably damaging 0.98
IGL00508:Adgrv1 APN 13 81506187 missense probably damaging 1.00
IGL00727:Adgrv1 APN 13 81524684 missense probably damaging 0.98
IGL00781:Adgrv1 APN 13 81578230 missense probably benign 0.19
IGL00816:Adgrv1 APN 13 81397203 missense probably benign 0.01
IGL00844:Adgrv1 APN 13 81540119 missense probably damaging 1.00
IGL00923:Adgrv1 APN 13 81382291 missense probably damaging 0.99
IGL01113:Adgrv1 APN 13 81489028 missense probably benign 0.00
IGL01143:Adgrv1 APN 13 81419351 missense probably benign 0.00
IGL01151:Adgrv1 APN 13 81405399 missense probably benign 0.00
IGL01153:Adgrv1 APN 13 81419128 missense probably benign 0.01
IGL01363:Adgrv1 APN 13 81557065 missense probably damaging 1.00
IGL01419:Adgrv1 APN 13 81557158 missense probably damaging 0.99
IGL01545:Adgrv1 APN 13 81466184 missense possibly damaging 0.46
IGL01701:Adgrv1 APN 13 81419631 missense possibly damaging 0.55
IGL01796:Adgrv1 APN 13 81567342 missense probably benign 0.01
IGL01816:Adgrv1 APN 13 81529049 missense probably benign 0.00
IGL01871:Adgrv1 APN 13 81472394 critical splice donor site probably null
IGL01955:Adgrv1 APN 13 81182783 missense probably damaging 1.00
IGL01956:Adgrv1 APN 13 81446430 missense possibly damaging 0.63
IGL01988:Adgrv1 APN 13 81557309 missense probably damaging 0.99
IGL01990:Adgrv1 APN 13 81556996 missense probably damaging 1.00
IGL02007:Adgrv1 APN 13 81568743 splice site probably benign
IGL02016:Adgrv1 APN 13 81397453 missense probably damaging 1.00
IGL02095:Adgrv1 APN 13 81579790 missense possibly damaging 0.63
IGL02174:Adgrv1 APN 13 81427664 missense probably benign 0.34
IGL02270:Adgrv1 APN 13 81559195 unclassified probably null
IGL02328:Adgrv1 APN 13 81578175 missense probably damaging 1.00
IGL02350:Adgrv1 APN 13 81270855 missense probably benign 0.00
IGL02357:Adgrv1 APN 13 81270855 missense probably benign 0.00
IGL02373:Adgrv1 APN 13 81459713 missense possibly damaging 0.90
IGL02402:Adgrv1 APN 13 81559424 missense probably benign 0.18
IGL02407:Adgrv1 APN 13 81479670 missense probably damaging 1.00
IGL02508:Adgrv1 APN 13 81435556 splice site probably benign
IGL02603:Adgrv1 APN 13 81488952 missense possibly damaging 0.93
IGL02648:Adgrv1 APN 13 81511619 missense probably benign 0.35
IGL02720:Adgrv1 APN 13 81578872 missense probably damaging 0.99
IGL02870:Adgrv1 APN 13 81563732 missense probably benign 0.13
IGL02896:Adgrv1 APN 13 81520739 missense probably damaging 1.00
IGL02931:Adgrv1 APN 13 81579714 missense probably damaging 1.00
IGL02952:Adgrv1 APN 13 81433636 missense probably benign 0.00
IGL02961:Adgrv1 APN 13 81523612 missense probably damaging 1.00
IGL02999:Adgrv1 APN 13 81578854 missense probably benign 0.12
IGL03067:Adgrv1 APN 13 81442480 missense probably damaging 1.00
IGL03106:Adgrv1 APN 13 81472899 missense probably benign 0.00
IGL03108:Adgrv1 APN 13 81559529 missense probably damaging 1.00
IGL03119:Adgrv1 APN 13 81382373 missense probably damaging 1.00
IGL03119:Adgrv1 APN 13 81433700 missense probably benign 0.02
IGL03169:Adgrv1 APN 13 81503900 missense probably damaging 1.00
IGL03186:Adgrv1 APN 13 81433618 missense possibly damaging 0.80
IGL03196:Adgrv1 APN 13 81446478 missense probably benign 0.02
IGL03207:Adgrv1 APN 13 81106898 splice site probably null
IGL03343:Adgrv1 APN 13 81283388 missense probably damaging 1.00
IGL03348:Adgrv1 APN 13 81499058 missense possibly damaging 0.54
IGL03349:Adgrv1 APN 13 81481336 missense probably benign 0.09
IGL03373:Adgrv1 APN 13 81563632 missense probably damaging 0.99
IGL03381:Adgrv1 APN 13 81517967 missense probably damaging 0.99
beatle UTSW 13 81579594 nonsense probably null
Escape UTSW 13 81435705 missense probably benign 0.02
lento UTSW 13 81270897 missense probably damaging 1.00
Metronome UTSW 13 81435559 critical splice donor site probably null
Nome UTSW 13 81391767 missense probably benign 0.00
Propulsion UTSW 13 81475047 missense probably benign 0.06
revulsion UTSW 13 81595182 missense probably damaging 1.00
Saturnv UTSW 13 81531676 missense probably damaging 1.00
Thrust UTSW 13 81374256 missense probably benign 0.01
Velocity UTSW 13 81397354 missense probably benign 0.00
Wilting UTSW 13 81492501 missense probably benign 0.02
Withering UTSW 13 81494657 missense probably damaging 1.00
F2404:Adgrv1 UTSW 13 81420006 missense probably benign 0.13
I2288:Adgrv1 UTSW 13 81437524 missense probably damaging 1.00
I2289:Adgrv1 UTSW 13 81437524 missense probably damaging 1.00
PIT4377001:Adgrv1 UTSW 13 81528985 missense probably damaging 1.00
PIT4504001:Adgrv1 UTSW 13 81559352 missense probably damaging 0.99
R0017:Adgrv1 UTSW 13 81578946 missense probably benign 0.13
R0017:Adgrv1 UTSW 13 81578946 missense probably benign 0.13
R0058:Adgrv1 UTSW 13 81182672 missense possibly damaging 0.65
R0058:Adgrv1 UTSW 13 81182672 missense possibly damaging 0.65
R0083:Adgrv1 UTSW 13 81578404 unclassified probably benign
R0087:Adgrv1 UTSW 13 81386951 missense probably damaging 1.00
R0108:Adgrv1 UTSW 13 81578404 unclassified probably benign
R0131:Adgrv1 UTSW 13 81502995 unclassified probably benign
R0218:Adgrv1 UTSW 13 81106898 splice site probably null
R0325:Adgrv1 UTSW 13 81540015 missense probably damaging 1.00
R0326:Adgrv1 UTSW 13 81474993 missense possibly damaging 0.46
R0395:Adgrv1 UTSW 13 81385953 missense probably benign 0.00
R0441:Adgrv1 UTSW 13 81397226 nonsense probably null
R0466:Adgrv1 UTSW 13 81566296 missense probably benign 0.00
R0487:Adgrv1 UTSW 13 81489035 missense probably damaging 1.00
R0501:Adgrv1 UTSW 13 81559150 missense probably damaging 1.00
R0522:Adgrv1 UTSW 13 81528442 splice site probably benign
R0532:Adgrv1 UTSW 13 81578896 missense probably damaging 1.00
R0542:Adgrv1 UTSW 13 81573318 missense probably damaging 1.00
R0681:Adgrv1 UTSW 13 81528530 missense probably damaging 1.00
R0689:Adgrv1 UTSW 13 81475105 missense possibly damaging 0.47
R0732:Adgrv1 UTSW 13 81503004 missense possibly damaging 0.86
R0746:Adgrv1 UTSW 13 81570556 missense probably benign 0.10
R0763:Adgrv1 UTSW 13 81499125 missense probably damaging 0.98
R0846:Adgrv1 UTSW 13 81479742 nonsense probably null
R0962:Adgrv1 UTSW 13 81405346 missense probably benign 0.01
R1146:Adgrv1 UTSW 13 81531676 missense probably damaging 1.00
R1146:Adgrv1 UTSW 13 81531676 missense probably damaging 1.00
R1172:Adgrv1 UTSW 13 81557063 missense probably damaging 0.98
R1178:Adgrv1 UTSW 13 81440037 splice site probably benign
R1310:Adgrv1 UTSW 13 81566377 missense probably benign 0.09
R1386:Adgrv1 UTSW 13 81528865 missense probably benign 0.17
R1387:Adgrv1 UTSW 13 81493176 missense possibly damaging 0.62
R1395:Adgrv1 UTSW 13 81386788 missense probably benign 0.05
R1412:Adgrv1 UTSW 13 81095450 missense probably damaging 1.00
R1448:Adgrv1 UTSW 13 81433513 missense probably benign 0.08
R1470:Adgrv1 UTSW 13 81382298 missense probably benign 0.03
R1470:Adgrv1 UTSW 13 81382298 missense probably benign 0.03
R1485:Adgrv1 UTSW 13 81579619 missense probably damaging 1.00
R1507:Adgrv1 UTSW 13 81472580 critical splice acceptor site probably null
R1513:Adgrv1 UTSW 13 81556957 missense probably damaging 1.00
R1513:Adgrv1 UTSW 13 81593048 missense probably damaging 1.00
R1539:Adgrv1 UTSW 13 81503978 unclassified probably null
R1579:Adgrv1 UTSW 13 81563779 missense probably damaging 1.00
R1580:Adgrv1 UTSW 13 81466160 critical splice donor site probably null
R1611:Adgrv1 UTSW 13 81559117 missense probably damaging 1.00
R1615:Adgrv1 UTSW 13 81424288 missense probably benign 0.41
R1651:Adgrv1 UTSW 13 81487853 missense probably benign 0.19
R1660:Adgrv1 UTSW 13 81476631 missense probably benign 0.00
R1679:Adgrv1 UTSW 13 81559552 missense probably damaging 1.00
R1709:Adgrv1 UTSW 13 81593060 missense probably damaging 1.00
R1735:Adgrv1 UTSW 13 81487947 missense possibly damaging 0.62
R1762:Adgrv1 UTSW 13 81506146 missense probably benign 0.08
R1830:Adgrv1 UTSW 13 81489077 missense possibly damaging 0.65
R1836:Adgrv1 UTSW 13 81504113 missense probably benign 0.01
R1843:Adgrv1 UTSW 13 81544533 missense probably damaging 1.00
R1863:Adgrv1 UTSW 13 81563566 missense probably damaging 1.00
R1895:Adgrv1 UTSW 13 81374249 missense probably damaging 1.00
R1907:Adgrv1 UTSW 13 81592551 splice site probably benign
R1928:Adgrv1 UTSW 13 81520786 missense probably benign 0.00
R1938:Adgrv1 UTSW 13 81391757 missense probably damaging 0.99
R1944:Adgrv1 UTSW 13 81510911 missense probably damaging 1.00
R1946:Adgrv1 UTSW 13 81374249 missense probably damaging 1.00
R1984:Adgrv1 UTSW 13 81523749 missense probably damaging 1.00
R2027:Adgrv1 UTSW 13 81595182 missense probably damaging 1.00
R2063:Adgrv1 UTSW 13 81561469 missense possibly damaging 0.81
R2116:Adgrv1 UTSW 13 81529013 missense probably benign 0.11
R2117:Adgrv1 UTSW 13 81492537 missense probably benign 0.00
R2125:Adgrv1 UTSW 13 81419535 missense probably benign 0.00
R2125:Adgrv1 UTSW 13 81419950 missense probably benign 0.02
R2127:Adgrv1 UTSW 13 81557080 missense probably damaging 1.00
R2128:Adgrv1 UTSW 13 81557080 missense probably damaging 1.00
R2129:Adgrv1 UTSW 13 81557080 missense probably damaging 1.00
R2130:Adgrv1 UTSW 13 81581727 missense possibly damaging 0.61
R2135:Adgrv1 UTSW 13 81524557 critical splice donor site probably null
R2138:Adgrv1 UTSW 13 81445320 missense probably benign 0.00
R2166:Adgrv1 UTSW 13 81568643 missense probably damaging 1.00
R2171:Adgrv1 UTSW 13 81270918 missense probably damaging 1.00
R2191:Adgrv1 UTSW 13 81566290 missense possibly damaging 0.90
R2256:Adgrv1 UTSW 13 81506140 missense probably benign
R2260:Adgrv1 UTSW 13 81568374 missense probably damaging 0.97
R2323:Adgrv1 UTSW 13 81595179 missense probably damaging 1.00
R2432:Adgrv1 UTSW 13 81540132 frame shift probably null
R2910:Adgrv1 UTSW 13 81557119 missense possibly damaging 0.61
R2920:Adgrv1 UTSW 13 81448865 missense probably benign 0.01
R2989:Adgrv1 UTSW 13 81581747 missense probably damaging 1.00
R3402:Adgrv1 UTSW 13 81543542 missense probably damaging 1.00
R3692:Adgrv1 UTSW 13 81524600 missense possibly damaging 0.91
R3711:Adgrv1 UTSW 13 81419475 missense probably benign 0.02
R3732:Adgrv1 UTSW 13 81556956 missense probably damaging 1.00
R3732:Adgrv1 UTSW 13 81556956 missense probably damaging 1.00
R3733:Adgrv1 UTSW 13 81556956 missense probably damaging 1.00
R3773:Adgrv1 UTSW 13 81499043 missense probably damaging 0.98
R3791:Adgrv1 UTSW 13 81593102 missense probably damaging 1.00
R3794:Adgrv1 UTSW 13 81283367 start codon destroyed probably damaging 1.00
R3848:Adgrv1 UTSW 13 81440072 missense probably damaging 0.97
R3880:Adgrv1 UTSW 13 81435705 missense probably benign 0.02
R3925:Adgrv1 UTSW 13 81578772 missense possibly damaging 0.89
R3934:Adgrv1 UTSW 13 81475047 missense probably benign 0.06
R3942:Adgrv1 UTSW 13 81182789 missense probably damaging 1.00
R4002:Adgrv1 UTSW 13 81540132 frame shift probably null
R4003:Adgrv1 UTSW 13 81540132 frame shift probably null
R4194:Adgrv1 UTSW 13 81498996 missense probably damaging 0.98
R4308:Adgrv1 UTSW 13 81440192 missense probably damaging 0.96
R4368:Adgrv1 UTSW 13 81492910 missense unknown
R4388:Adgrv1 UTSW 13 81581709 missense probably damaging 0.98
R4421:Adgrv1 UTSW 13 81566302 missense probably damaging 1.00
R4468:Adgrv1 UTSW 13 81374256 missense probably benign 0.01
R4483:Adgrv1 UTSW 13 81419230 missense probably benign 0.01
R4487:Adgrv1 UTSW 13 81440066 missense probably damaging 0.99
R4566:Adgrv1 UTSW 13 81419808 missense probably damaging 1.00
R4615:Adgrv1 UTSW 13 81494569 splice site probably null
R4647:Adgrv1 UTSW 13 81528795 nonsense probably null
R4657:Adgrv1 UTSW 13 81405364 missense probably benign 0.01
R4723:Adgrv1 UTSW 13 81433525 missense probably benign 0.02
R4765:Adgrv1 UTSW 13 81106919 missense probably damaging 0.99
R4783:Adgrv1 UTSW 13 81095445 missense probably damaging 0.99
R4796:Adgrv1 UTSW 13 81155231 nonsense probably null
R4816:Adgrv1 UTSW 13 81528674 missense probably damaging 1.00
R4833:Adgrv1 UTSW 13 81560844 missense possibly damaging 0.81
R4841:Adgrv1 UTSW 13 81503001 critical splice donor site probably null
R4871:Adgrv1 UTSW 13 81533122 intron probably benign
R4897:Adgrv1 UTSW 13 81561585 splice site probably null
R4906:Adgrv1 UTSW 13 81270738 splice site probably null
R4917:Adgrv1 UTSW 13 81510877 missense probably benign 0.30
R4996:Adgrv1 UTSW 13 81578734 missense probably benign 0.01
R5030:Adgrv1 UTSW 13 81459829 missense probably benign 0.43
R5044:Adgrv1 UTSW 13 81488931 missense probably benign 0.01
R5052:Adgrv1 UTSW 13 81528821 missense probably damaging 0.97
R5093:Adgrv1 UTSW 13 81592585 missense probably damaging 1.00
R5095:Adgrv1 UTSW 13 81095487 missense probably benign 0.00
R5119:Adgrv1 UTSW 13 81419427 missense possibly damaging 0.93
R5133:Adgrv1 UTSW 13 81439441 missense probably damaging 1.00
R5141:Adgrv1 UTSW 13 81270918 missense probably damaging 1.00
R5164:Adgrv1 UTSW 13 81435674 missense probably benign 0.00
R5180:Adgrv1 UTSW 13 81283416 start gained probably benign
R5203:Adgrv1 UTSW 13 81510905 missense possibly damaging 0.91
R5241:Adgrv1 UTSW 13 81488929 nonsense probably null
R5280:Adgrv1 UTSW 13 81397465 missense possibly damaging 0.95
R5289:Adgrv1 UTSW 13 81521084 missense probably benign 0.04
R5304:Adgrv1 UTSW 13 81578253 missense possibly damaging 0.93
R5310:Adgrv1 UTSW 13 81476690 missense possibly damaging 0.95
R5338:Adgrv1 UTSW 13 81529046 missense possibly damaging 0.80
R5352:Adgrv1 UTSW 13 81494657 missense probably damaging 1.00
R5402:Adgrv1 UTSW 13 81459715 missense probably benign 0.25
R5418:Adgrv1 UTSW 13 81419308 missense probably benign 0.01
R5460:Adgrv1 UTSW 13 81424258 missense possibly damaging 0.95
R5510:Adgrv1 UTSW 13 81445244 missense probably damaging 1.00
R5521:Adgrv1 UTSW 13 81419389 missense probably benign 0.01
R5538:Adgrv1 UTSW 13 81433689 missense probably benign 0.02
R5561:Adgrv1 UTSW 13 81476564 missense probably damaging 0.99
R5584:Adgrv1 UTSW 13 81405267 missense probably damaging 1.00
R5608:Adgrv1 UTSW 13 81155276 missense probably damaging 1.00
R5610:Adgrv1 UTSW 13 81521117 missense probably damaging 1.00
R5619:Adgrv1 UTSW 13 81472500 missense probably damaging 1.00
R5751:Adgrv1 UTSW 13 81522236 missense probably damaging 1.00
R5832:Adgrv1 UTSW 13 81103302 missense possibly damaging 0.95
R5885:Adgrv1 UTSW 13 81424271 missense probably benign 0.15
R5930:Adgrv1 UTSW 13 81397451 missense probably benign 0.06
R5937:Adgrv1 UTSW 13 81107075 missense probably damaging 0.96
R5943:Adgrv1 UTSW 13 81386866 missense probably damaging 0.98
R5951:Adgrv1 UTSW 13 81442501 missense probably damaging 1.00
R5977:Adgrv1 UTSW 13 81435559 critical splice donor site probably null
R5995:Adgrv1 UTSW 13 81466259 missense probably benign 0.03
R6017:Adgrv1 UTSW 13 81397423 nonsense probably null
R6024:Adgrv1 UTSW 13 81476505 missense probably benign 0.26
R6049:Adgrv1 UTSW 13 81397354 missense probably benign 0.00
R6108:Adgrv1 UTSW 13 81391695 missense probably damaging 0.99
R6130:Adgrv1 UTSW 13 81427745 missense probably damaging 0.99
R6132:Adgrv1 UTSW 13 81506076 missense probably benign 0.04
R6149:Adgrv1 UTSW 13 81182774 missense probably damaging 1.00
R6169:Adgrv1 UTSW 13 81419259 missense probably benign 0.00
R6175:Adgrv1 UTSW 13 81386005 missense probably damaging 1.00
R6184:Adgrv1 UTSW 13 81433838 missense probably benign 0.01
R6190:Adgrv1 UTSW 13 81459763 synonymous probably null
R6190:Adgrv1 UTSW 13 81524779 splice site probably null
R6215:Adgrv1 UTSW 13 81579594 nonsense probably null
R6216:Adgrv1 UTSW 13 81524471 intron probably null
R6238:Adgrv1 UTSW 13 81466283 missense probably benign 0.07
R6244:Adgrv1 UTSW 13 81106931 missense probably damaging 1.00
R6298:Adgrv1 UTSW 13 81391767 missense probably benign 0.00
R6316:Adgrv1 UTSW 13 81499068 missense possibly damaging 0.63
R6336:Adgrv1 UTSW 13 81385981 missense probably benign 0.09
R6358:Adgrv1 UTSW 13 81414583 missense probably damaging 0.99
R6421:Adgrv1 UTSW 13 81508736 missense possibly damaging 0.69
R6466:Adgrv1 UTSW 13 81575101 unclassified probably null
R6467:Adgrv1 UTSW 13 81444538 missense probably benign 0.01
R6510:Adgrv1 UTSW 13 81559490 missense possibly damaging 0.88
R6519:Adgrv1 UTSW 13 81567343 missense probably benign 0.01
R6521:Adgrv1 UTSW 13 81433652 missense probably damaging 1.00
R6598:Adgrv1 UTSW 13 81506179 missense probably damaging 1.00
R6605:Adgrv1 UTSW 13 81487962 missense possibly damaging 0.80
R6626:Adgrv1 UTSW 13 81518126 missense probably damaging 1.00
R6633:Adgrv1 UTSW 13 81568643 missense probably damaging 1.00
R6721:Adgrv1 UTSW 13 81481515 missense probably benign 0.00
R6725:Adgrv1 UTSW 13 81437557 missense probably damaging 0.99
R6725:Adgrv1 UTSW 13 81493210 missense probably damaging 1.00
R6796:Adgrv1 UTSW 13 81472478 missense probably damaging 1.00
R6809:Adgrv1 UTSW 13 81472953 missense probably benign 0.01
R6823:Adgrv1 UTSW 13 81557081 missense probably damaging 1.00
R6876:Adgrv1 UTSW 13 81155154 critical splice donor site probably null
R6878:Adgrv1 UTSW 13 81433494 missense probably benign 0.06
R6887:Adgrv1 UTSW 13 81528701 missense probably benign 0.01
R6888:Adgrv1 UTSW 13 81508669 missense probably damaging 1.00
R6957:Adgrv1 UTSW 13 81567490 missense probably benign 0.00
R6976:Adgrv1 UTSW 13 81520997 missense probably damaging 1.00
R7003:Adgrv1 UTSW 13 81522104 critical splice donor site probably null
R7007:Adgrv1 UTSW 13 81536364 missense possibly damaging 0.80
R7073:Adgrv1 UTSW 13 81561474 missense probably damaging 1.00
R7100:Adgrv1 UTSW 13 81270897 missense probably damaging 1.00
R7107:Adgrv1 UTSW 13 81578142 missense probably benign 0.13
R7123:Adgrv1 UTSW 13 81592574 missense probably damaging 1.00
R7141:Adgrv1 UTSW 13 81492501 missense probably benign 0.02
R7168:Adgrv1 UTSW 13 81397209 missense possibly damaging 0.52
R7239:Adgrv1 UTSW 13 81476612 missense possibly damaging 0.69
R7249:Adgrv1 UTSW 13 81374259 missense probably damaging 1.00
R7313:Adgrv1 UTSW 13 81520515 missense possibly damaging 0.95
R7376:Adgrv1 UTSW 13 81518126 missense probably damaging 1.00
R7392:Adgrv1 UTSW 13 81560689 missense probably damaging 1.00
R7395:Adgrv1 UTSW 13 81559348 missense probably damaging 1.00
R7410:Adgrv1 UTSW 13 81563619 missense probably benign 0.04
R7449:Adgrv1 UTSW 13 81499073 missense probably damaging 0.99
R7496:Adgrv1 UTSW 13 81440225 missense possibly damaging 0.79
R7497:Adgrv1 UTSW 13 81440225 missense possibly damaging 0.79
R7498:Adgrv1 UTSW 13 81440225 missense possibly damaging 0.79
R7567:Adgrv1 UTSW 13 81433529 missense probably benign 0.00
R7567:Adgrv1 UTSW 13 81579477 missense probably damaging 1.00
R7614:Adgrv1 UTSW 13 81520661 missense probably damaging 1.00
R7623:Adgrv1 UTSW 13 81422225 missense possibly damaging 0.77
R7665:Adgrv1 UTSW 13 81499142 missense probably damaging 1.00
R7685:Adgrv1 UTSW 13 81103324 missense possibly damaging 0.94
R7788:Adgrv1 UTSW 13 81573314 missense probably damaging 1.00
R7809:Adgrv1 UTSW 13 81528641 missense possibly damaging 0.81
X0054:Adgrv1 UTSW 13 81559270 missense probably damaging 1.00
X0062:Adgrv1 UTSW 13 81386926 missense probably damaging 0.99
X0067:Adgrv1 UTSW 13 81543392 missense possibly damaging 0.51
Z1088:Adgrv1 UTSW 13 81476672 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ACAAATCTCCATTCCCAGTCTG -3'
(R):5'- ACATGTGGCAATGCAAAGC -3'

Sequencing Primer
(F):5'- GGTAGTGAACCTCAAAAAGCTTC -3'
(R):5'- CATGTGGCAATGCAAAGCAAAGATTG -3'
Posted On2019-06-26