Incidental Mutation 'R7206:Pam'
ID560587
Institutional Source Beutler Lab
Gene Symbol Pam
Ensembl Gene ENSMUSG00000026335
Gene Namepeptidylglycine alpha-amidating monooxygenase
SynonymsPHM
MMRRC Submission
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R7206 (G1)
Quality Score225.009
Status Validated
Chromosome1
Chromosomal Location97795114-98095646 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 97896032 bp
ZygosityHeterozygous
Amino Acid Change Serine to Proline at position 225 (S225P)
Ref Sequence ENSEMBL: ENSMUSP00000057112 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000058762] [ENSMUST00000097625] [ENSMUST00000161567]
Predicted Effect probably damaging
Transcript: ENSMUST00000058762
AA Change: S225P

PolyPhen 2 Score 0.995 (Sensitivity: 0.68; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000057112
Gene: ENSMUSG00000026335
AA Change: S225P

DomainStartEndE-ValueType
signal peptide 1 24 N/A INTRINSIC
Pfam:Cu2_monooxygen 62 178 7.8e-27 PFAM
Pfam:Cu2_monoox_C 199 346 6.2e-47 PFAM
Pfam:NHL 633 662 2.1e-8 PFAM
low complexity region 673 680 N/A INTRINSIC
Pfam:NHL 686 714 2.7e-8 PFAM
Pfam:NHL 782 809 2.8e-7 PFAM
transmembrane domain 870 892 N/A INTRINSIC
low complexity region 908 930 N/A INTRINSIC
low complexity region 950 969 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000097625
AA Change: S225P

PolyPhen 2 Score 0.995 (Sensitivity: 0.68; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000095228
Gene: ENSMUSG00000026335
AA Change: S225P

DomainStartEndE-ValueType
signal peptide 1 24 N/A INTRINSIC
Pfam:Cu2_monooxygen 60 183 3.7e-34 PFAM
Pfam:Cu2_monoox_C 198 349 1.4e-54 PFAM
Pfam:NHL 581 608 9.4e-9 PFAM
Pfam:NHL 633 662 2.1e-8 PFAM
low complexity region 673 680 N/A INTRINSIC
Pfam:NHL 686 714 2.2e-8 PFAM
Pfam:NHL 782 809 3.6e-8 PFAM
transmembrane domain 869 891 N/A INTRINSIC
low complexity region 907 929 N/A INTRINSIC
low complexity region 949 968 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000159841
SMART Domains Protein: ENSMUSP00000124479
Gene: ENSMUSG00000026335

DomainStartEndE-ValueType
Pfam:Cu2_monoox_C 1 53 4.3e-15 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000161567
AA Change: S225P

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000125418
Gene: ENSMUSG00000026335
AA Change: S225P

DomainStartEndE-ValueType
signal peptide 1 24 N/A INTRINSIC
Pfam:Cu2_monooxygen 60 183 3.2e-34 PFAM
Pfam:Cu2_monoox_C 198 349 1.2e-54 PFAM
Pfam:NHL 475 502 8.3e-9 PFAM
Pfam:NHL 527 556 1.9e-8 PFAM
low complexity region 567 574 N/A INTRINSIC
Pfam:NHL 580 608 1.9e-8 PFAM
Pfam:NHL 676 703 3.2e-8 PFAM
transmembrane domain 764 786 N/A INTRINSIC
low complexity region 802 824 N/A INTRINSIC
low complexity region 844 863 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 98.9%
Validation Efficiency 99% (87/88)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a multifunctional protein. The encoded preproprotein is proteolytically processed to generate the mature enzyme. This enzyme includes two domains with distinct catalytic activities, a peptidylglycine alpha-hydroxylating monooxygenase (PHM) domain and a peptidyl-alpha-hydroxyglycine alpha-amidating lyase (PAL) domain. These catalytic domains work sequentially to catalyze the conversion of neuroendocrine peptides to active alpha-amidated products. Alternative splicing results in multiple transcript variants, at least one of which encodes an isoform that is proteolytically processed. [provided by RefSeq, Jan 2016]
PHENOTYPE: Homozygous mutation of this gene results in embryonic lethality during fetal growth and development, edema, abnormal yolk sac vasculature, thin arterial walls, and abnormal bronchial epithelial morphology. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 87 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aadacl2 G A 3: 60,025,241 M392I probably benign Het
Acr T C 15: 89,574,171 S352P probably benign Het
Adam6a T C 12: 113,546,034 C676R probably damaging Het
Adgra3 T C 5: 50,006,896 D247G probably damaging Het
Agxt2 A T 15: 10,377,456 E147D probably damaging Het
Atp2a1 T C 7: 126,447,972 T805A probably benign Het
Atp8b4 T C 2: 126,458,292 S106G probably damaging Het
Ccdc170 T A 10: 4,514,120 M87K possibly damaging Het
Ccnl2 T G 4: 155,820,974 V287G possibly damaging Het
Ccr6 A T 17: 8,256,949 M329L probably benign Het
Cflar G T 1: 58,740,991 M248I Het
Cib4 A T 5: 30,545,766 L5* probably null Het
Col27a1 A T 4: 63,235,346 Y645F probably benign Het
Cxcr2 A G 1: 74,159,054 T236A possibly damaging Het
Dnah12 G A 14: 26,778,912 probably null Het
Dnah7a A T 1: 53,698,633 L47* probably null Het
Dnajb6 A C 5: 29,781,337 K301T possibly damaging Het
Dpf2 T A 19: 5,904,543 I157F possibly damaging Het
Drd4 G A 7: 141,292,119 G28R probably damaging Het
Dupd1 A G 14: 21,677,034 V182A probably damaging Het
Dus3l A T 17: 56,767,807 I310F probably damaging Het
Eef1akmt3 A G 10: 127,040,993 L95P probably damaging Het
Fabp7 C T 10: 57,784,991 probably benign Het
Fam135a T C 1: 24,030,273 N505S probably benign Het
Fam213a T A 14: 41,004,185 M12L probably benign Het
Fam216b C A 14: 78,085,127 D46Y probably damaging Het
Gata6 C T 18: 11,054,850 R260C probably damaging Het
Gm10800 A AC 2: 98,667,033 probably null Het
Gm13124 T A 4: 144,558,641 D142V probably damaging Het
Golgb1 A G 16: 36,913,749 I1160M probably benign Het
Hfe2 A T 3: 96,528,128 D234V probably damaging Het
Kiss1 A G 1: 133,327,325 K26E probably benign Het
Knl1 T A 2: 119,069,299 F494I probably benign Het
Ktn1 T C 14: 47,695,528 L713S probably damaging Het
Loxhd1 A G 18: 77,441,817 D2052G probably damaging Het
Lpo A C 11: 87,807,423 L582R probably damaging Het
Map2k3 A G 11: 60,943,580 T125A Het
Matn3 T A 12: 8,961,170 N360K probably benign Het
Mlip A T 9: 77,164,862 V237E probably damaging Het
Mms22l T C 4: 24,591,146 V999A probably benign Het
Mn1 A G 5: 111,420,512 K783E possibly damaging Het
Myo1h A T 5: 114,319,775 K132* probably null Het
Nle1 A G 11: 82,904,931 V230A probably benign Het
Olfr1240 T C 2: 89,440,457 probably benign Het
Olfr1318 T G 2: 112,156,459 C169W probably damaging Het
Olfr22-ps1 A T 11: 73,954,821 I44F probably benign Het
Olfr356 T A 2: 36,937,772 Y218N probably damaging Het
Olfr564 T C 7: 102,803,684 S69P probably damaging Het
Olfr860 C T 9: 19,846,560 D20N probably damaging Het
Ormdl2 T A 10: 128,820,415 H7L possibly damaging Het
Pan2 C A 10: 128,314,545 Y719* probably null Het
Ppfia4 T C 1: 134,327,389 S243G probably benign Het
Ppig T G 2: 69,741,566 S210A unknown Het
Ppwd1 A T 13: 104,213,598 N426K probably damaging Het
Rnf10 T G 5: 115,244,121 D675A probably benign Het
Rrp12 A T 19: 41,878,039 L619H probably damaging Het
Rsph10b C T 5: 143,961,192 T497I possibly damaging Het
Scnm1 A T 3: 95,133,894 M1K probably null Het
Scp2 G T 4: 108,074,441 D332E probably benign Het
Senp3 T C 11: 69,678,731 I314V probably benign Het
Sfmbt1 T A 14: 30,811,373 probably null Het
Slc44a2 T C 9: 21,346,807 F451S probably damaging Het
Slfn1 A T 11: 83,122,011 M318L probably benign Het
Syne2 C T 12: 76,004,757 S4087L probably benign Het
Syt7 A G 19: 10,417,973 Y49C probably damaging Het
Tas2r134 T C 2: 51,628,108 Y200H probably benign Het
Tgfbr1 A T 4: 47,402,941 H315L probably damaging Het
Tmem184c A G 8: 77,596,577 V552A possibly damaging Het
Tnxb A G 17: 34,704,101 R2553G possibly damaging Het
Tomm40 C G 7: 19,710,936 R173S probably benign Het
Tonsl T C 15: 76,633,651 D650G probably damaging Het
Tpo G C 12: 30,103,134 S407W possibly damaging Het
Trank1 T C 9: 111,345,515 probably null Het
Trp53tg5 T C 2: 164,471,458 E99G probably damaging Het
Tubb2a C A 13: 34,075,522 S95I possibly damaging Het
Vav2 C A 2: 27,336,719 R114L probably benign Het
Vmn1r172 A T 7: 23,660,157 I156L possibly damaging Het
Vmn1r238 A G 18: 3,122,623 Y264H possibly damaging Het
Vmn2r26 T A 6: 124,039,768 M397K probably benign Het
Vmn2r73 T C 7: 85,872,867 N88S probably benign Het
Vps13a T C 19: 16,754,298 N150S probably damaging Het
Vps35 A T 8: 85,287,721 Y100N probably damaging Het
Vps8 A C 16: 21,457,421 I235L probably damaging Het
Yipf2 T A 9: 21,590,361 H157L probably damaging Het
Zfp354a A T 11: 51,070,246 H426L probably damaging Het
Zfp503 G T 14: 21,985,485 S454R possibly damaging Het
Zfp619 C T 7: 39,535,400 R285C probably benign Het
Other mutations in Pam
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00467:Pam APN 1 97924427 splice site probably benign
IGL00485:Pam APN 1 97822953 missense possibly damaging 0.78
IGL00597:Pam APN 1 97834444 missense probably benign 0.02
IGL01585:Pam APN 1 97864472 missense probably damaging 0.99
IGL01776:Pam APN 1 97885600 critical splice donor site probably null
IGL01981:Pam APN 1 97834441 missense probably damaging 1.00
IGL02152:Pam APN 1 97840749 missense probably damaging 1.00
IGL02605:Pam APN 1 97840339 missense possibly damaging 0.85
IGL02882:Pam APN 1 97840367 missense probably damaging 1.00
IGL03142:Pam APN 1 97894386 missense probably damaging 1.00
IGL03409:Pam APN 1 97864329 missense probably benign 0.04
R0084:Pam UTSW 1 97896049 missense probably benign 0.01
R0200:Pam UTSW 1 97894401 unclassified probably null
R0520:Pam UTSW 1 97884195 missense probably benign 0.00
R0734:Pam UTSW 1 97864362 nonsense probably null
R1881:Pam UTSW 1 97923151 missense probably benign 0.06
R2040:Pam UTSW 1 97864442 missense possibly damaging 0.55
R2106:Pam UTSW 1 97831490 missense probably damaging 1.00
R2913:Pam UTSW 1 97923129 missense probably damaging 1.00
R3148:Pam UTSW 1 97895678 missense possibly damaging 0.84
R3618:Pam UTSW 1 97834432 missense probably damaging 1.00
R3619:Pam UTSW 1 97834432 missense probably damaging 1.00
R3847:Pam UTSW 1 97854756 intron probably benign
R3848:Pam UTSW 1 97854756 intron probably benign
R3849:Pam UTSW 1 97854756 intron probably benign
R4128:Pam UTSW 1 97834468 missense probably damaging 0.99
R4231:Pam UTSW 1 97884124 critical splice donor site probably null
R4233:Pam UTSW 1 97864394 missense possibly damaging 0.86
R4404:Pam UTSW 1 97854721 intron probably benign
R4536:Pam UTSW 1 97844699 nonsense probably null
R4738:Pam UTSW 1 97923132 missense probably damaging 1.00
R5054:Pam UTSW 1 97821917 missense probably damaging 1.00
R5501:Pam UTSW 1 97840365 nonsense probably null
R5572:Pam UTSW 1 97854744 intron probably benign
R5654:Pam UTSW 1 97864398 missense probably benign 0.00
R5659:Pam UTSW 1 97842299 missense probably damaging 1.00
R6112:Pam UTSW 1 97834468 missense probably damaging 0.99
R6513:Pam UTSW 1 97838027 missense possibly damaging 0.60
R6696:Pam UTSW 1 97885727 missense possibly damaging 0.79
R6743:Pam UTSW 1 97896049 missense probably benign 0.01
R6833:Pam UTSW 1 97837992 missense probably damaging 0.99
R6834:Pam UTSW 1 97837992 missense probably damaging 0.99
R7098:Pam UTSW 1 97898347 missense probably benign
R7117:Pam UTSW 1 97977116 start gained probably benign
R7152:Pam UTSW 1 97885740 missense probably damaging 1.00
R7172:Pam UTSW 1 97834478 missense probably benign 0.10
R7262:Pam UTSW 1 97854723 missense
R7434:Pam UTSW 1 97975790 nonsense probably null
R7466:Pam UTSW 1 97842247 missense probably damaging 1.00
R7513:Pam UTSW 1 97853185 missense possibly damaging 0.88
R7790:Pam UTSW 1 97821847 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GCATCATAAGAGTTCAAGGAATTCG -3'
(R):5'- AGGCTCTTAACACGCGTTAG -3'

Sequencing Primer
(F):5'- TCGAGAAGATATACTTAAGGTCCAGC -3'
(R):5'- GAATAAACGTTTGATACCTGCTGGG -3'
Posted On2019-06-26