Incidental Mutation 'R7206:Knl1'
ID560596
Institutional Source Beutler Lab
Gene Symbol Knl1
Ensembl Gene ENSMUSG00000027326
Gene Namekinetochore scaffold 1
Synonyms2310043D08Rik, 5730505K17Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R7206 (G1)
Quality Score225.009
Status Validated
Chromosome2
Chromosomal Location119047119-119105501 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 119069299 bp
ZygosityHeterozygous
Amino Acid Change Phenylalanine to Isoleucine at position 494 (F494I)
Ref Sequence ENSEMBL: ENSMUSP00000028799 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000028799] [ENSMUST00000028802] [ENSMUST00000099542] [ENSMUST00000152380] [ENSMUST00000153300]
Predicted Effect probably benign
Transcript: ENSMUST00000028799
AA Change: F494I

PolyPhen 2 Score 0.351 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000028799
Gene: ENSMUSG00000027326
AA Change: F494I

DomainStartEndE-ValueType
low complexity region 49 58 N/A INTRINSIC
PDB:4A1G|H 126 175 1e-13 PDB
low complexity region 426 433 N/A INTRINSIC
low complexity region 883 894 N/A INTRINSIC
low complexity region 1148 1159 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000028802
AA Change: F494I

PolyPhen 2 Score 0.174 (Sensitivity: 0.92; Specificity: 0.87)
SMART Domains Protein: ENSMUSP00000028802
Gene: ENSMUSG00000027326
AA Change: F494I

DomainStartEndE-ValueType
low complexity region 49 58 N/A INTRINSIC
internal_repeat_1 98 304 1.57e-6 PROSPERO
low complexity region 426 433 N/A INTRINSIC
internal_repeat_1 610 824 1.57e-6 PROSPERO
low complexity region 883 894 N/A INTRINSIC
low complexity region 1148 1159 N/A INTRINSIC
low complexity region 1621 1644 N/A INTRINSIC
coiled coil region 1724 1755 N/A INTRINSIC
low complexity region 1836 1850 N/A INTRINSIC
low complexity region 1864 1878 N/A INTRINSIC
PDB:4NF9|B 1899 2119 1e-115 PDB
Predicted Effect probably benign
Transcript: ENSMUST00000099542
AA Change: F494I

PolyPhen 2 Score 0.174 (Sensitivity: 0.92; Specificity: 0.87)
SMART Domains Protein: ENSMUSP00000097140
Gene: ENSMUSG00000027326
AA Change: F494I

DomainStartEndE-ValueType
low complexity region 49 58 N/A INTRINSIC
internal_repeat_1 98 304 1.57e-6 PROSPERO
low complexity region 426 433 N/A INTRINSIC
internal_repeat_1 610 824 1.57e-6 PROSPERO
low complexity region 883 894 N/A INTRINSIC
low complexity region 1148 1159 N/A INTRINSIC
low complexity region 1621 1644 N/A INTRINSIC
coiled coil region 1724 1755 N/A INTRINSIC
low complexity region 1836 1850 N/A INTRINSIC
low complexity region 1864 1878 N/A INTRINSIC
PDB:4NF9|B 1899 2119 1e-115 PDB
Predicted Effect probably benign
Transcript: ENSMUST00000152380
SMART Domains Protein: ENSMUSP00000118646
Gene: ENSMUSG00000027326

DomainStartEndE-ValueType
low complexity region 49 58 N/A INTRINSIC
PDB:4A1G|H 126 175 3e-14 PDB
low complexity region 426 433 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000153300
SMART Domains Protein: ENSMUSP00000120905
Gene: ENSMUSG00000027326

DomainStartEndE-ValueType
low complexity region 49 58 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 98.9%
Validation Efficiency 99% (87/88)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a component of the multiprotein assembly that is required for creation of kinetochore-microtubule attachments and chromosome segregation. The encoded protein functions as a scaffold for proteins that influence the spindle assembly checkpoint during the eukaryotic cell cycle and it interacts with at least five different kinetochore proteins and two checkpoint kinases. In adults, this gene is predominantly expressed in normal testes, various cancer cell lines and primary tumors from other tissues and is ubiquitously expressed in fetal tissues. This gene was originally identified as a fusion partner with the mixed-lineage leukemia (MLL) gene in t(11;15)(q23;q14). Mutations in this gene cause autosomal recessive primary microcephaly-4 (MCPH4). Alternative splicing results in multiple transcript variants encoding different isoforms. Additional splice variants have been described but their biological validity has not been confirmed. [provided by RefSeq, Jan 2013]
PHENOTYPE: Mice homozygous for a transgenic gene disruption exhibit embryonic lethality at E6. Mice homozygous for an ENU-induced allele exhibit possible embryonic lethality. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 87 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aadacl2 G A 3: 60,025,241 M392I probably benign Het
Acr T C 15: 89,574,171 S352P probably benign Het
Adam6a T C 12: 113,546,034 C676R probably damaging Het
Adgra3 T C 5: 50,006,896 D247G probably damaging Het
Agxt2 A T 15: 10,377,456 E147D probably damaging Het
Atp2a1 T C 7: 126,447,972 T805A probably benign Het
Atp8b4 T C 2: 126,458,292 S106G probably damaging Het
Ccdc170 T A 10: 4,514,120 M87K possibly damaging Het
Ccnl2 T G 4: 155,820,974 V287G possibly damaging Het
Ccr6 A T 17: 8,256,949 M329L probably benign Het
Cflar G T 1: 58,740,991 M248I Het
Cib4 A T 5: 30,545,766 L5* probably null Het
Col27a1 A T 4: 63,235,346 Y645F probably benign Het
Cxcr2 A G 1: 74,159,054 T236A possibly damaging Het
Dnah12 G A 14: 26,778,912 probably null Het
Dnah7a A T 1: 53,698,633 L47* probably null Het
Dnajb6 A C 5: 29,781,337 K301T possibly damaging Het
Dpf2 T A 19: 5,904,543 I157F possibly damaging Het
Drd4 G A 7: 141,292,119 G28R probably damaging Het
Dupd1 A G 14: 21,677,034 V182A probably damaging Het
Dus3l A T 17: 56,767,807 I310F probably damaging Het
Eef1akmt3 A G 10: 127,040,993 L95P probably damaging Het
Fabp7 C T 10: 57,784,991 probably benign Het
Fam135a T C 1: 24,030,273 N505S probably benign Het
Fam213a T A 14: 41,004,185 M12L probably benign Het
Fam216b C A 14: 78,085,127 D46Y probably damaging Het
Gata6 C T 18: 11,054,850 R260C probably damaging Het
Gm10800 A AC 2: 98,667,033 probably null Het
Gm13124 T A 4: 144,558,641 D142V probably damaging Het
Golgb1 A G 16: 36,913,749 I1160M probably benign Het
Hfe2 A T 3: 96,528,128 D234V probably damaging Het
Kiss1 A G 1: 133,327,325 K26E probably benign Het
Ktn1 T C 14: 47,695,528 L713S probably damaging Het
Loxhd1 A G 18: 77,441,817 D2052G probably damaging Het
Lpo A C 11: 87,807,423 L582R probably damaging Het
Map2k3 A G 11: 60,943,580 T125A Het
Matn3 T A 12: 8,961,170 N360K probably benign Het
Mlip A T 9: 77,164,862 V237E probably damaging Het
Mms22l T C 4: 24,591,146 V999A probably benign Het
Mn1 A G 5: 111,420,512 K783E possibly damaging Het
Myo1h A T 5: 114,319,775 K132* probably null Het
Nle1 A G 11: 82,904,931 V230A probably benign Het
Olfr1240 T C 2: 89,440,457 probably benign Het
Olfr1318 T G 2: 112,156,459 C169W probably damaging Het
Olfr22-ps1 A T 11: 73,954,821 I44F probably benign Het
Olfr356 T A 2: 36,937,772 Y218N probably damaging Het
Olfr564 T C 7: 102,803,684 S69P probably damaging Het
Olfr860 C T 9: 19,846,560 D20N probably damaging Het
Ormdl2 T A 10: 128,820,415 H7L possibly damaging Het
Pam A G 1: 97,896,032 S225P probably damaging Het
Pan2 C A 10: 128,314,545 Y719* probably null Het
Ppfia4 T C 1: 134,327,389 S243G probably benign Het
Ppig T G 2: 69,741,566 S210A unknown Het
Ppwd1 A T 13: 104,213,598 N426K probably damaging Het
Rnf10 T G 5: 115,244,121 D675A probably benign Het
Rrp12 A T 19: 41,878,039 L619H probably damaging Het
Rsph10b C T 5: 143,961,192 T497I possibly damaging Het
Scnm1 A T 3: 95,133,894 M1K probably null Het
Scp2 G T 4: 108,074,441 D332E probably benign Het
Senp3 T C 11: 69,678,731 I314V probably benign Het
Sfmbt1 T A 14: 30,811,373 probably null Het
Slc44a2 T C 9: 21,346,807 F451S probably damaging Het
Slfn1 A T 11: 83,122,011 M318L probably benign Het
Syne2 C T 12: 76,004,757 S4087L probably benign Het
Syt7 A G 19: 10,417,973 Y49C probably damaging Het
Tas2r134 T C 2: 51,628,108 Y200H probably benign Het
Tgfbr1 A T 4: 47,402,941 H315L probably damaging Het
Tmem184c A G 8: 77,596,577 V552A possibly damaging Het
Tnxb A G 17: 34,704,101 R2553G possibly damaging Het
Tomm40 C G 7: 19,710,936 R173S probably benign Het
Tonsl T C 15: 76,633,651 D650G probably damaging Het
Tpo G C 12: 30,103,134 S407W possibly damaging Het
Trank1 T C 9: 111,345,515 probably null Het
Trp53tg5 T C 2: 164,471,458 E99G probably damaging Het
Tubb2a C A 13: 34,075,522 S95I possibly damaging Het
Vav2 C A 2: 27,336,719 R114L probably benign Het
Vmn1r172 A T 7: 23,660,157 I156L possibly damaging Het
Vmn1r238 A G 18: 3,122,623 Y264H possibly damaging Het
Vmn2r26 T A 6: 124,039,768 M397K probably benign Het
Vmn2r73 T C 7: 85,872,867 N88S probably benign Het
Vps13a T C 19: 16,754,298 N150S probably damaging Het
Vps35 A T 8: 85,287,721 Y100N probably damaging Het
Vps8 A C 16: 21,457,421 I235L probably damaging Het
Yipf2 T A 9: 21,590,361 H157L probably damaging Het
Zfp354a A T 11: 51,070,246 H426L probably damaging Het
Zfp503 G T 14: 21,985,485 S454R possibly damaging Het
Zfp619 C T 7: 39,535,400 R285C probably benign Het
Other mutations in Knl1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00272:Knl1 APN 2 119064083 missense probably damaging 0.96
IGL00582:Knl1 APN 2 119102499 missense probably benign 0.19
IGL00666:Knl1 APN 2 119070464 missense probably damaging 0.96
IGL01062:Knl1 APN 2 119076980 missense probably benign 0.33
IGL01395:Knl1 APN 2 119071566 missense probably damaging 0.96
IGL01604:Knl1 APN 2 119070001 missense probably damaging 1.00
IGL01996:Knl1 APN 2 119104061 missense probably damaging 1.00
IGL02086:Knl1 APN 2 119100774 missense probably benign 0.40
IGL02105:Knl1 APN 2 119071808 missense probably benign
IGL02106:Knl1 APN 2 119072008 missense possibly damaging 0.89
IGL02201:Knl1 APN 2 119069152 missense probably benign 0.01
IGL02252:Knl1 APN 2 119072540 missense probably damaging 1.00
IGL02414:Knl1 APN 2 119070323 missense possibly damaging 0.83
IGL02655:Knl1 APN 2 119070992 missense possibly damaging 0.62
IGL02682:Knl1 APN 2 119077969 missense possibly damaging 0.86
IGL02710:Knl1 APN 2 119070930 missense probably damaging 0.99
IGL02877:Knl1 APN 2 119088831 missense probably benign 0.08
IGL03100:Knl1 APN 2 119100770 missense probably damaging 0.99
IGL03210:Knl1 APN 2 119070617 missense probably benign 0.02
IGL03138:Knl1 UTSW 2 119072359 missense probably damaging 0.96
R0023:Knl1 UTSW 2 119102549 missense possibly damaging 0.73
R0064:Knl1 UTSW 2 119076243 missense probably benign 0.00
R0064:Knl1 UTSW 2 119076243 missense probably benign 0.00
R0078:Knl1 UTSW 2 119069892 missense probably benign 0.16
R0178:Knl1 UTSW 2 119058405 splice site probably benign
R0295:Knl1 UTSW 2 119088839 missense probably damaging 1.00
R0433:Knl1 UTSW 2 119104061 missense probably damaging 0.96
R0453:Knl1 UTSW 2 119068388 missense probably damaging 1.00
R0569:Knl1 UTSW 2 119097435 missense possibly damaging 0.95
R0827:Knl1 UTSW 2 119088901 splice site probably benign
R0920:Knl1 UTSW 2 119069828 missense probably benign 0.00
R1120:Knl1 UTSW 2 119062375 missense probably damaging 0.99
R1155:Knl1 UTSW 2 119071154 missense possibly damaging 0.90
R1204:Knl1 UTSW 2 119071189 missense probably benign 0.00
R1241:Knl1 UTSW 2 119072573 missense probably benign 0.03
R1387:Knl1 UTSW 2 119070730 missense possibly damaging 0.93
R1448:Knl1 UTSW 2 119068307 missense probably damaging 1.00
R1469:Knl1 UTSW 2 119071346 missense possibly damaging 0.73
R1469:Knl1 UTSW 2 119071346 missense possibly damaging 0.73
R1719:Knl1 UTSW 2 119071738 missense probably benign 0.01
R1721:Knl1 UTSW 2 119076334 missense probably damaging 1.00
R2128:Knl1 UTSW 2 119071819 missense possibly damaging 0.79
R2170:Knl1 UTSW 2 119087594 critical splice donor site probably null
R2227:Knl1 UTSW 2 119072000 missense probably damaging 0.97
R2246:Knl1 UTSW 2 119072227 missense probably damaging 1.00
R2275:Knl1 UTSW 2 119072281 missense probably damaging 0.99
R2508:Knl1 UTSW 2 119058368 nonsense probably null
R3115:Knl1 UTSW 2 119070391 missense possibly damaging 0.53
R3122:Knl1 UTSW 2 119068944 missense probably benign 0.32
R3431:Knl1 UTSW 2 119062362 missense probably damaging 1.00
R3755:Knl1 UTSW 2 119102579 missense probably damaging 1.00
R4461:Knl1 UTSW 2 119059599 missense probably benign 0.00
R4600:Knl1 UTSW 2 119070544 missense possibly damaging 0.90
R4713:Knl1 UTSW 2 119069137 nonsense probably null
R4758:Knl1 UTSW 2 119071732 frame shift probably null
R4762:Knl1 UTSW 2 119071936 missense probably benign 0.01
R4869:Knl1 UTSW 2 119072351 missense possibly damaging 0.73
R4870:Knl1 UTSW 2 119081513 missense probably benign 0.22
R4935:Knl1 UTSW 2 119068957 missense possibly damaging 0.50
R5167:Knl1 UTSW 2 119070031 missense probably damaging 1.00
R5184:Knl1 UTSW 2 119069176 missense probably damaging 1.00
R5293:Knl1 UTSW 2 119069695 missense probably damaging 0.99
R5326:Knl1 UTSW 2 119068348 missense possibly damaging 0.66
R5331:Knl1 UTSW 2 119070255 missense possibly damaging 0.92
R5353:Knl1 UTSW 2 119070983 missense probably benign 0.01
R5493:Knl1 UTSW 2 119068730 missense probably damaging 0.98
R5542:Knl1 UTSW 2 119068348 missense possibly damaging 0.66
R5632:Knl1 UTSW 2 119070352 missense probably damaging 1.00
R5650:Knl1 UTSW 2 119081550 nonsense probably null
R5854:Knl1 UTSW 2 119070403 missense probably benign 0.02
R5979:Knl1 UTSW 2 119069360 missense possibly damaging 0.83
R6086:Knl1 UTSW 2 119094068 missense probably damaging 1.00
R6283:Knl1 UTSW 2 119070286 missense probably damaging 1.00
R6285:Knl1 UTSW 2 119071941 missense probably damaging 1.00
R6313:Knl1 UTSW 2 119069318 missense probably damaging 1.00
R6419:Knl1 UTSW 2 119069003 missense probably benign 0.02
R6608:Knl1 UTSW 2 119086612 missense probably damaging 0.99
R6881:Knl1 UTSW 2 119095184 missense possibly damaging 0.67
R7161:Knl1 UTSW 2 119070785 missense possibly damaging 0.79
R7270:Knl1 UTSW 2 119102522 missense possibly damaging 0.53
R7276:Knl1 UTSW 2 119071686 missense probably damaging 0.98
R7358:Knl1 UTSW 2 119070559 missense possibly damaging 0.92
R7402:Knl1 UTSW 2 119095226 nonsense probably null
R7408:Knl1 UTSW 2 119070592 missense possibly damaging 0.54
R7475:Knl1 UTSW 2 119087546 missense probably damaging 1.00
R7516:Knl1 UTSW 2 119070698 missense probably damaging 0.99
R7524:Knl1 UTSW 2 119065979 missense probably damaging 1.00
R7559:Knl1 UTSW 2 119094006 missense possibly damaging 0.84
R7607:Knl1 UTSW 2 119095133 missense possibly damaging 0.93
R7745:Knl1 UTSW 2 119071556 missense probably benign 0.13
R7847:Knl1 UTSW 2 119070976 missense probably benign 0.02
Predicted Primers PCR Primer
(F):5'- AAGTGTCTATCAGCTATGGAAGAG -3'
(R):5'- CCATATCTTCATCTGCCAAGAATTC -3'

Sequencing Primer
(F):5'- GCTGAAGGCTGATGATAAGTATTC -3'
(R):5'- GCCAAGAATTCCATCTTTTTGTCAG -3'
Posted On2019-06-26