Mutagenetix > Incidental Mutation

Incidental Mutation 'R7206:Knl1'

560596

Institutional Source

Beutler Lab

Gene Symbol

Knl1

Ensembl Gene

ENSMUSG00000027326

Gene Name

kinetochore scaffold 1

Synonyms

2310043D08Rik, 5730505K17Rik

MMRRC Submission

Accession Numbers

Essential gene?

Essential (E-score: 1.000) question?

Stock #

R7206 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

119047119-119105501 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to A at 119069299 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Phenylalanine to Isoleucine at position 494 (F494I)

Ref Sequence

ENSEMBL: ENSMUSP00000028799 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000028799] [ENSMUST00000028802] [ENSMUST00000099542] [ENSMUST00000152380] [ENSMUST00000153300]

AlphaFold

Q66JQ7

Predicted Effect

probably benign
Transcript: ENSMUST00000028799
AA Change: F494I

PolyPhen 2 Score 0.351 (Sensitivity: 0.90; Specificity: 0.89)

SMART Domains

Protein: ENSMUSP00000028799
Gene: ENSMUSG00000027326
AA Change: F494I

Domain	Start	End	E-Value	Type
low complexity region	49	58	N/A	INTRINSIC
PDB:4A1G\|H	126	175	1e-13	PDB
low complexity region	426	433	N/A	INTRINSIC
low complexity region	883	894	N/A	INTRINSIC
low complexity region	1148	1159	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000028802
AA Change: F494I

PolyPhen 2 Score 0.174 (Sensitivity: 0.92; Specificity: 0.87)

SMART Domains

Protein: ENSMUSP00000028802
Gene: ENSMUSG00000027326
AA Change: F494I

Domain	Start	End	E-Value	Type
low complexity region	49	58	N/A	INTRINSIC
internal_repeat_1	98	304	1.57e-6	PROSPERO
low complexity region	426	433	N/A	INTRINSIC
internal_repeat_1	610	824	1.57e-6	PROSPERO
low complexity region	883	894	N/A	INTRINSIC
low complexity region	1148	1159	N/A	INTRINSIC
low complexity region	1621	1644	N/A	INTRINSIC
coiled coil region	1724	1755	N/A	INTRINSIC
low complexity region	1836	1850	N/A	INTRINSIC
low complexity region	1864	1878	N/A	INTRINSIC
PDB:4NF9\|B	1899	2119	1e-115	PDB

Predicted Effect

probably benign
Transcript: ENSMUST00000099542
AA Change: F494I

PolyPhen 2 Score 0.174 (Sensitivity: 0.92; Specificity: 0.87)

SMART Domains

Protein: ENSMUSP00000097140
Gene: ENSMUSG00000027326
AA Change: F494I

Domain	Start	End	E-Value	Type
low complexity region	49	58	N/A	INTRINSIC
internal_repeat_1	98	304	1.57e-6	PROSPERO
low complexity region	426	433	N/A	INTRINSIC
internal_repeat_1	610	824	1.57e-6	PROSPERO
low complexity region	883	894	N/A	INTRINSIC
low complexity region	1148	1159	N/A	INTRINSIC
low complexity region	1621	1644	N/A	INTRINSIC
coiled coil region	1724	1755	N/A	INTRINSIC
low complexity region	1836	1850	N/A	INTRINSIC
low complexity region	1864	1878	N/A	INTRINSIC
PDB:4NF9\|B	1899	2119	1e-115	PDB

Predicted Effect

probably benign
Transcript: ENSMUST00000152380

SMART Domains

Protein: ENSMUSP00000118646
Gene: ENSMUSG00000027326

Domain	Start	End	E-Value	Type
low complexity region	49	58	N/A	INTRINSIC
PDB:4A1G\|H	126	175	3e-14	PDB
low complexity region	426	433	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000153300

SMART Domains

Protein: ENSMUSP00000120905
Gene: ENSMUSG00000027326

Domain	Start	End	E-Value	Type
low complexity region	49	58	N/A	INTRINSIC

Coding Region Coverage

1x: 100.0%
3x: 100.0%
10x: 99.7%
20x: 98.9%

Validation Efficiency

99% (87/88)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a component of the multiprotein assembly that is required for creation of kinetochore-microtubule attachments and chromosome segregation. The encoded protein functions as a scaffold for proteins that influence the spindle assembly checkpoint during the eukaryotic cell cycle and it interacts with at least five different kinetochore proteins and two checkpoint kinases. In adults, this gene is predominantly expressed in normal testes, various cancer cell lines and primary tumors from other tissues and is ubiquitously expressed in fetal tissues. This gene was originally identified as a fusion partner with the mixed-lineage leukemia (MLL) gene in t(11;15)(q23;q14). Mutations in this gene cause autosomal recessive primary microcephaly-4 (MCPH4). Alternative splicing results in multiple transcript variants encoding different isoforms. Additional splice variants have been described but their biological validity has not been confirmed. [provided by RefSeq, Jan 2013]
PHENOTYPE: Mice homozygous for a transgenic gene disruption exhibit embryonic lethality at E6. Mice homozygous for an ENU-induced allele exhibit possible embryonic lethality. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 87 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Aadacl2	G	A	3: 60,025,241	M392I	probably benign	Het
Acr	T	C	15: 89,574,171	S352P	probably benign	Het
Adam6a	T	C	12: 113,546,034	C676R	probably damaging	Het
Adgra3	T	C	5: 50,006,896	D247G	probably damaging	Het
Agxt2	A	T	15: 10,377,456	E147D	probably damaging	Het
Atp2a1	T	C	7: 126,447,972	T805A	probably benign	Het
Atp8b4	T	C	2: 126,458,292	S106G	probably damaging	Het
Ccdc170	T	A	10: 4,514,120	M87K	possibly damaging	Het
Ccnl2	T	G	4: 155,820,974	V287G	possibly damaging	Het
Ccr6	A	T	17: 8,256,949	M329L	probably benign	Het
Cflar	G	T	1: 58,740,991	M248I		Het
Cib4	A	T	5: 30,545,766	L5*	probably null	Het
Col27a1	A	T	4: 63,235,346	Y645F	probably benign	Het
Cxcr2	A	G	1: 74,159,054	T236A	possibly damaging	Het
Dnah12	G	A	14: 26,778,912		probably null	Het
Dnah7a	A	T	1: 53,698,633	L47*	probably null	Het
Dnajb6	A	C	5: 29,781,337	K301T	possibly damaging	Het
Dpf2	T	A	19: 5,904,543	I157F	possibly damaging	Het
Drd4	G	A	7: 141,292,119	G28R	probably damaging	Het
Dupd1	A	G	14: 21,677,034	V182A	probably damaging	Het
Dus3l	A	T	17: 56,767,807	I310F	probably damaging	Het
Eef1akmt3	A	G	10: 127,040,993	L95P	probably damaging	Het
Fabp7	C	T	10: 57,784,991		probably benign	Het
Fam135a	T	C	1: 24,030,273	N505S	probably benign	Het
Fam213a	T	A	14: 41,004,185	M12L	probably benign	Het
Fam216b	C	A	14: 78,085,127	D46Y	probably damaging	Het
Gata6	C	T	18: 11,054,850	R260C	probably damaging	Het
Gm10800	A	AC	2: 98,667,033		probably null	Het
Gm13124	T	A	4: 144,558,641	D142V	probably damaging	Het
Golgb1	A	G	16: 36,913,749	I1160M	probably benign	Het
Hfe2	A	T	3: 96,528,128	D234V	probably damaging	Het
Kiss1	A	G	1: 133,327,325	K26E	probably benign	Het
Ktn1	T	C	14: 47,695,528	L713S	probably damaging	Het
Loxhd1	A	G	18: 77,441,817	D2052G	probably damaging	Het
Lpo	A	C	11: 87,807,423	L582R	probably damaging	Het
Map2k3	A	G	11: 60,943,580	T125A		Het
Matn3	T	A	12: 8,961,170	N360K	probably benign	Het
Mlip	A	T	9: 77,164,862	V237E	probably damaging	Het
Mms22l	T	C	4: 24,591,146	V999A	probably benign	Het
Mn1	A	G	5: 111,420,512	K783E	possibly damaging	Het
Myo1h	A	T	5: 114,319,775	K132*	probably null	Het
Nle1	A	G	11: 82,904,931	V230A	probably benign	Het
Olfr1240	T	C	2: 89,440,457		probably benign	Het
Olfr1318	T	G	2: 112,156,459	C169W	probably damaging	Het
Olfr22-ps1	A	T	11: 73,954,821	I44F	probably benign	Het
Olfr356	T	A	2: 36,937,772	Y218N	probably damaging	Het
Olfr564	T	C	7: 102,803,684	S69P	probably damaging	Het
Olfr860	C	T	9: 19,846,560	D20N	probably damaging	Het
Ormdl2	T	A	10: 128,820,415	H7L	possibly damaging	Het
Pam	A	G	1: 97,896,032	S225P	probably damaging	Het
Pan2	C	A	10: 128,314,545	Y719*	probably null	Het
Ppfia4	T	C	1: 134,327,389	S243G	probably benign	Het
Ppig	T	G	2: 69,741,566	S210A	unknown	Het
Ppwd1	A	T	13: 104,213,598	N426K	probably damaging	Het
Rnf10	T	G	5: 115,244,121	D675A	probably benign	Het
Rrp12	A	T	19: 41,878,039	L619H	probably damaging	Het
Rsph10b	C	T	5: 143,961,192	T497I	possibly damaging	Het
Scnm1	A	T	3: 95,133,894	M1K	probably null	Het
Scp2	G	T	4: 108,074,441	D332E	probably benign	Het
Senp3	T	C	11: 69,678,731	I314V	probably benign	Het
Sfmbt1	T	A	14: 30,811,373		probably null	Het
Slc44a2	T	C	9: 21,346,807	F451S	probably damaging	Het
Slfn1	A	T	11: 83,122,011	M318L	probably benign	Het
Syne2	C	T	12: 76,004,757	S4087L	probably benign	Het
Syt7	A	G	19: 10,417,973	Y49C	probably damaging	Het
Tas2r134	T	C	2: 51,628,108	Y200H	probably benign	Het
Tgfbr1	A	T	4: 47,402,941	H315L	probably damaging	Het
Tmem184c	A	G	8: 77,596,577	V552A	possibly damaging	Het
Tnxb	A	G	17: 34,704,101	R2553G	possibly damaging	Het
Tomm40	C	G	7: 19,710,936	R173S	probably benign	Het
Tonsl	T	C	15: 76,633,651	D650G	probably damaging	Het
Tpo	G	C	12: 30,103,134	S407W	possibly damaging	Het
Trank1	T	C	9: 111,345,515		probably null	Het
Trp53tg5	T	C	2: 164,471,458	E99G	probably damaging	Het
Tubb2a	C	A	13: 34,075,522	S95I	possibly damaging	Het
Vav2	C	A	2: 27,336,719	R114L	probably benign	Het
Vmn1r172	A	T	7: 23,660,157	I156L	possibly damaging	Het
Vmn1r238	A	G	18: 3,122,623	Y264H	possibly damaging	Het
Vmn2r26	T	A	6: 124,039,768	M397K	probably benign	Het
Vmn2r73	T	C	7: 85,872,867	N88S	probably benign	Het
Vps13a	T	C	19: 16,754,298	N150S	probably damaging	Het
Vps35	A	T	8: 85,287,721	Y100N	probably damaging	Het
Vps8	A	C	16: 21,457,421	I235L	probably damaging	Het
Yipf2	T	A	9: 21,590,361	H157L	probably damaging	Het
Zfp354a	A	T	11: 51,070,246	H426L	probably damaging	Het
Zfp503	G	T	14: 21,985,485	S454R	possibly damaging	Het
Zfp619	C	T	7: 39,535,400	R285C	probably benign	Het

Other mutations in Knl1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00272:Knl1	APN	2	119064083	missense	probably damaging	0.96
IGL00582:Knl1	APN	2	119102499	missense	probably benign	0.19
IGL00666:Knl1	APN	2	119070464	missense	probably damaging	0.96
IGL01062:Knl1	APN	2	119076980	missense	probably benign	0.33
IGL01395:Knl1	APN	2	119071566	missense	probably damaging	0.96
IGL01604:Knl1	APN	2	119070001	missense	probably damaging	1.00
IGL01996:Knl1	APN	2	119104061	missense	probably damaging	1.00
IGL02086:Knl1	APN	2	119100774	missense	probably benign	0.40
IGL02105:Knl1	APN	2	119071808	missense	probably benign
IGL02106:Knl1	APN	2	119072008	missense	possibly damaging	0.89
IGL02201:Knl1	APN	2	119069152	missense	probably benign	0.01
IGL02252:Knl1	APN	2	119072540	missense	probably damaging	1.00
IGL02414:Knl1	APN	2	119070323	missense	possibly damaging	0.83
IGL02655:Knl1	APN	2	119070992	missense	possibly damaging	0.62
IGL02682:Knl1	APN	2	119077969	missense	possibly damaging	0.86
IGL02710:Knl1	APN	2	119070930	missense	probably damaging	0.99
IGL02877:Knl1	APN	2	119088831	missense	probably benign	0.08
IGL03100:Knl1	APN	2	119100770	missense	probably damaging	0.99
IGL03210:Knl1	APN	2	119070617	missense	probably benign	0.02
IGL03138:Knl1	UTSW	2	119072359	missense	probably damaging	0.96
R0023:Knl1	UTSW	2	119102549	missense	possibly damaging	0.73
R0064:Knl1	UTSW	2	119076243	missense	probably benign	0.00
R0064:Knl1	UTSW	2	119076243	missense	probably benign	0.00
R0078:Knl1	UTSW	2	119069892	missense	probably benign	0.16
R0178:Knl1	UTSW	2	119058405	splice site	probably benign
R0295:Knl1	UTSW	2	119088839	missense	probably damaging	1.00
R0433:Knl1	UTSW	2	119104061	missense	probably damaging	0.96
R0453:Knl1	UTSW	2	119068388	missense	probably damaging	1.00
R0569:Knl1	UTSW	2	119097435	missense	possibly damaging	0.95
R0827:Knl1	UTSW	2	119088901	splice site	probably benign
R0920:Knl1	UTSW	2	119069828	missense	probably benign	0.00
R1120:Knl1	UTSW	2	119062375	missense	probably damaging	0.99
R1155:Knl1	UTSW	2	119071154	missense	possibly damaging	0.90
R1204:Knl1	UTSW	2	119071189	missense	probably benign	0.00
R1241:Knl1	UTSW	2	119072573	missense	probably benign	0.03
R1387:Knl1	UTSW	2	119070730	missense	possibly damaging	0.93
R1448:Knl1	UTSW	2	119068307	missense	probably damaging	1.00
R1469:Knl1	UTSW	2	119071346	missense	possibly damaging	0.73
R1469:Knl1	UTSW	2	119071346	missense	possibly damaging	0.73
R1719:Knl1	UTSW	2	119071738	missense	probably benign	0.01
R1721:Knl1	UTSW	2	119076334	missense	probably damaging	1.00
R2128:Knl1	UTSW	2	119071819	missense	possibly damaging	0.79
R2170:Knl1	UTSW	2	119087594	critical splice donor site	probably null
R2227:Knl1	UTSW	2	119072000	missense	probably damaging	0.97
R2246:Knl1	UTSW	2	119072227	missense	probably damaging	1.00
R2275:Knl1	UTSW	2	119072281	missense	probably damaging	0.99
R2508:Knl1	UTSW	2	119058368	nonsense	probably null
R3115:Knl1	UTSW	2	119070391	missense	possibly damaging	0.53
R3122:Knl1	UTSW	2	119068944	missense	probably benign	0.32
R3431:Knl1	UTSW	2	119062362	missense	probably damaging	1.00
R3755:Knl1	UTSW	2	119102579	missense	probably damaging	1.00
R4461:Knl1	UTSW	2	119059599	missense	probably benign	0.00
R4600:Knl1	UTSW	2	119070544	missense	possibly damaging	0.90
R4713:Knl1	UTSW	2	119069137	nonsense	probably null
R4758:Knl1	UTSW	2	119071732	frame shift	probably null
R4762:Knl1	UTSW	2	119071936	missense	probably benign	0.01
R4869:Knl1	UTSW	2	119072351	missense	possibly damaging	0.73
R4870:Knl1	UTSW	2	119081513	missense	probably benign	0.22
R4935:Knl1	UTSW	2	119068957	missense	possibly damaging	0.50
R5167:Knl1	UTSW	2	119070031	missense	probably damaging	1.00
R5184:Knl1	UTSW	2	119069176	missense	probably damaging	1.00
R5293:Knl1	UTSW	2	119069695	missense	probably damaging	0.99
R5326:Knl1	UTSW	2	119068348	missense	possibly damaging	0.66
R5331:Knl1	UTSW	2	119070255	missense	possibly damaging	0.92
R5353:Knl1	UTSW	2	119070983	missense	probably benign	0.01
R5493:Knl1	UTSW	2	119068730	missense	probably damaging	0.98
R5542:Knl1	UTSW	2	119068348	missense	possibly damaging	0.66
R5632:Knl1	UTSW	2	119070352	missense	probably damaging	1.00
R5650:Knl1	UTSW	2	119081550	nonsense	probably null
R5854:Knl1	UTSW	2	119070403	missense	probably benign	0.02
R5979:Knl1	UTSW	2	119069360	missense	possibly damaging	0.83
R6086:Knl1	UTSW	2	119094068	missense	probably damaging	1.00
R6283:Knl1	UTSW	2	119070286	missense	probably damaging	1.00
R6285:Knl1	UTSW	2	119071941	missense	probably damaging	1.00
R6313:Knl1	UTSW	2	119069318	missense	probably damaging	1.00
R6419:Knl1	UTSW	2	119069003	missense	probably benign	0.02
R6608:Knl1	UTSW	2	119086612	missense	probably damaging	0.99
R6881:Knl1	UTSW	2	119095184	missense	possibly damaging	0.67
R7161:Knl1	UTSW	2	119070785	missense	possibly damaging	0.79
R7270:Knl1	UTSW	2	119102522	missense	possibly damaging	0.53
R7276:Knl1	UTSW	2	119071686	missense	probably damaging	0.98
R7358:Knl1	UTSW	2	119070559	missense	possibly damaging	0.92
R7402:Knl1	UTSW	2	119095226	nonsense	probably null
R7408:Knl1	UTSW	2	119070592	missense	possibly damaging	0.54
R7475:Knl1	UTSW	2	119087546	missense	probably damaging	1.00
R7516:Knl1	UTSW	2	119070698	missense	probably damaging	0.99
R7524:Knl1	UTSW	2	119065979	missense	probably damaging	1.00
R7559:Knl1	UTSW	2	119094006	missense	possibly damaging	0.84
R7607:Knl1	UTSW	2	119095133	missense	possibly damaging	0.93
R7745:Knl1	UTSW	2	119071556	missense	probably benign	0.13
R7847:Knl1	UTSW	2	119070976	missense	probably benign	0.02
R8423:Knl1	UTSW	2	119070032	missense	probably damaging	1.00
R8725:Knl1	UTSW	2	119069043	missense	probably benign	0.34
R8727:Knl1	UTSW	2	119069043	missense	probably benign	0.34
R8995:Knl1	UTSW	2	119072509	missense	probably benign	0.11
R9023:Knl1	UTSW	2	119070280	missense	probably benign	0.27
R9100:Knl1	UTSW	2	119068988	missense	probably benign	0.02
R9102:Knl1	UTSW	2	119087492	missense	probably benign	0.22
R9303:Knl1	UTSW	2	119068348	missense	possibly damaging	0.83
R9400:Knl1	UTSW	2	119100743	missense	probably damaging	0.98
R9426:Knl1	UTSW	2	119069498	missense	possibly damaging	0.81
R9583:Knl1	UTSW	2	119057301	missense	probably damaging	1.00
R9616:Knl1	UTSW	2	119069513	missense	probably benign	0.02
R9616:Knl1	UTSW	2	119076944	missense	probably damaging	1.00
R9671:Knl1	UTSW	2	119070608	missense	probably damaging	1.00
R9766:Knl1	UTSW	2	119069900	missense	probably damaging	1.00
R9782:Knl1	UTSW	2	119069429	missense	probably benign	0.02

Predicted Primers

PCR Primer
(F):5'- AAGTGTCTATCAGCTATGGAAGAG -3'
(R):5'- CCATATCTTCATCTGCCAAGAATTC -3'

Sequencing Primer
(F):5'- GCTGAAGGCTGATGATAAGTATTC -3'
(R):5'- GCCAAGAATTCCATCTTTTTGTCAG -3'

Posted On

2019-06-26