Incidental Mutation 'R7206:Adgra3'
ID560610
Institutional Source Beutler Lab
Gene Symbol Adgra3
Ensembl Gene ENSMUSG00000029090
Gene Nameadhesion G protein-coupled receptor A3
SynonymsGpr125, Tem5-like, 3830613O22Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R7206 (G1)
Quality Score225.009
Status Validated
Chromosome5
Chromosomal Location49959956-50059006 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 50006896 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glycine at position 247 (D247G)
Ref Sequence ENSEMBL: ENSMUSP00000030971 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000030971]
Predicted Effect probably damaging
Transcript: ENSMUST00000030971
AA Change: D247G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000030971
Gene: ENSMUSG00000029090
AA Change: D247G

DomainStartEndE-ValueType
signal peptide 1 27 N/A INTRINSIC
low complexity region 36 48 N/A INTRINSIC
LRR 68 92 1.71e1 SMART
LRR_TYP 93 116 2.27e-4 SMART
LRR_TYP 117 140 4.11e-2 SMART
LRR_TYP 141 164 3.89e-3 SMART
LRRCT 176 225 5.24e-5 SMART
IG 238 331 8.26e-5 SMART
GPS 686 738 4.81e-3 SMART
Pfam:7tm_2 746 1031 1.6e-16 PFAM
low complexity region 1251 1262 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 98.9%
Validation Efficiency 99% (87/88)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the G protein-coupled receptor superfamily. This membrane protein may play a role in tumor angiogenesis through its interaction with the human homolog of the Drosophila disc large tumor suppressor gene. This gene is mapped to a candidate region of chromosome 4 which may be associated with bipolar disorder and schizophrenia. [provided by RefSeq, Oct 2012]
PHENOTYPE: Homozygous mutant mice are fertile and grossly normal. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 87 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aadacl2 G A 3: 60,025,241 M392I probably benign Het
Acr T C 15: 89,574,171 S352P probably benign Het
Adam6a T C 12: 113,546,034 C676R probably damaging Het
Agxt2 A T 15: 10,377,456 E147D probably damaging Het
Atp2a1 T C 7: 126,447,972 T805A probably benign Het
Atp8b4 T C 2: 126,458,292 S106G probably damaging Het
Ccdc170 T A 10: 4,514,120 M87K possibly damaging Het
Ccnl2 T G 4: 155,820,974 V287G possibly damaging Het
Ccr6 A T 17: 8,256,949 M329L probably benign Het
Cflar G T 1: 58,740,991 M248I Het
Cib4 A T 5: 30,545,766 L5* probably null Het
Col27a1 A T 4: 63,235,346 Y645F probably benign Het
Cxcr2 A G 1: 74,159,054 T236A possibly damaging Het
Dnah12 G A 14: 26,778,912 probably null Het
Dnah7a A T 1: 53,698,633 L47* probably null Het
Dnajb6 A C 5: 29,781,337 K301T possibly damaging Het
Dpf2 T A 19: 5,904,543 I157F possibly damaging Het
Drd4 G A 7: 141,292,119 G28R probably damaging Het
Dupd1 A G 14: 21,677,034 V182A probably damaging Het
Dus3l A T 17: 56,767,807 I310F probably damaging Het
Eef1akmt3 A G 10: 127,040,993 L95P probably damaging Het
Fabp7 C T 10: 57,784,991 probably benign Het
Fam135a T C 1: 24,030,273 N505S probably benign Het
Fam213a T A 14: 41,004,185 M12L probably benign Het
Fam216b C A 14: 78,085,127 D46Y probably damaging Het
Gata6 C T 18: 11,054,850 R260C probably damaging Het
Gm10800 A AC 2: 98,667,033 probably null Het
Gm13124 T A 4: 144,558,641 D142V probably damaging Het
Golgb1 A G 16: 36,913,749 I1160M probably benign Het
Hfe2 A T 3: 96,528,128 D234V probably damaging Het
Kiss1 A G 1: 133,327,325 K26E probably benign Het
Knl1 T A 2: 119,069,299 F494I probably benign Het
Ktn1 T C 14: 47,695,528 L713S probably damaging Het
Loxhd1 A G 18: 77,441,817 D2052G probably damaging Het
Lpo A C 11: 87,807,423 L582R probably damaging Het
Map2k3 A G 11: 60,943,580 T125A Het
Matn3 T A 12: 8,961,170 N360K probably benign Het
Mlip A T 9: 77,164,862 V237E probably damaging Het
Mms22l T C 4: 24,591,146 V999A probably benign Het
Mn1 A G 5: 111,420,512 K783E possibly damaging Het
Myo1h A T 5: 114,319,775 K132* probably null Het
Nle1 A G 11: 82,904,931 V230A probably benign Het
Olfr1240 T C 2: 89,440,457 probably benign Het
Olfr1318 T G 2: 112,156,459 C169W probably damaging Het
Olfr22-ps1 A T 11: 73,954,821 I44F probably benign Het
Olfr356 T A 2: 36,937,772 Y218N probably damaging Het
Olfr564 T C 7: 102,803,684 S69P probably damaging Het
Olfr860 C T 9: 19,846,560 D20N probably damaging Het
Ormdl2 T A 10: 128,820,415 H7L possibly damaging Het
Pam A G 1: 97,896,032 S225P probably damaging Het
Pan2 C A 10: 128,314,545 Y719* probably null Het
Ppfia4 T C 1: 134,327,389 S243G probably benign Het
Ppig T G 2: 69,741,566 S210A unknown Het
Ppwd1 A T 13: 104,213,598 N426K probably damaging Het
Rnf10 T G 5: 115,244,121 D675A probably benign Het
Rrp12 A T 19: 41,878,039 L619H probably damaging Het
Rsph10b C T 5: 143,961,192 T497I possibly damaging Het
Scnm1 A T 3: 95,133,894 M1K probably null Het
Scp2 G T 4: 108,074,441 D332E probably benign Het
Senp3 T C 11: 69,678,731 I314V probably benign Het
Sfmbt1 T A 14: 30,811,373 probably null Het
Slc44a2 T C 9: 21,346,807 F451S probably damaging Het
Slfn1 A T 11: 83,122,011 M318L probably benign Het
Syne2 C T 12: 76,004,757 S4087L probably benign Het
Syt7 A G 19: 10,417,973 Y49C probably damaging Het
Tas2r134 T C 2: 51,628,108 Y200H probably benign Het
Tgfbr1 A T 4: 47,402,941 H315L probably damaging Het
Tmem184c A G 8: 77,596,577 V552A possibly damaging Het
Tnxb A G 17: 34,704,101 R2553G possibly damaging Het
Tomm40 C G 7: 19,710,936 R173S probably benign Het
Tonsl T C 15: 76,633,651 D650G probably damaging Het
Tpo G C 12: 30,103,134 S407W possibly damaging Het
Trank1 T C 9: 111,345,515 probably null Het
Trp53tg5 T C 2: 164,471,458 E99G probably damaging Het
Tubb2a C A 13: 34,075,522 S95I possibly damaging Het
Vav2 C A 2: 27,336,719 R114L probably benign Het
Vmn1r172 A T 7: 23,660,157 I156L possibly damaging Het
Vmn1r238 A G 18: 3,122,623 Y264H possibly damaging Het
Vmn2r26 T A 6: 124,039,768 M397K probably benign Het
Vmn2r73 T C 7: 85,872,867 N88S probably benign Het
Vps13a T C 19: 16,754,298 N150S probably damaging Het
Vps35 A T 8: 85,287,721 Y100N probably damaging Het
Vps8 A C 16: 21,457,421 I235L probably damaging Het
Yipf2 T A 9: 21,590,361 H157L probably damaging Het
Zfp354a A T 11: 51,070,246 H426L probably damaging Het
Zfp503 G T 14: 21,985,485 S454R possibly damaging Het
Zfp619 C T 7: 39,535,400 R285C probably benign Het
Other mutations in Adgra3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00777:Adgra3 APN 5 50025758 missense probably damaging 1.00
IGL00848:Adgra3 APN 5 50001949 missense probably damaging 1.00
IGL01455:Adgra3 APN 5 49987557 nonsense probably null
IGL01665:Adgra3 APN 5 50006930 missense possibly damaging 0.64
IGL02151:Adgra3 APN 5 49979142 missense probably benign
IGL02239:Adgra3 APN 5 49960712 missense probably damaging 1.00
IGL02351:Adgra3 APN 5 50058558 missense probably benign 0.19
IGL02358:Adgra3 APN 5 50058558 missense probably benign 0.19
IGL02938:Adgra3 APN 5 49961317 missense probably benign 0.01
IGL03028:Adgra3 APN 5 50016852 missense probably benign 0.30
aperture UTSW 5 49999145 nonsense probably null
saltatory UTSW 5 49960559 missense probably benign 0.09
ANU74:Adgra3 UTSW 5 49961038 missense probably benign 0.16
R0041:Adgra3 UTSW 5 49960559 missense probably benign 0.09
R0121:Adgra3 UTSW 5 50025786 splice site probably benign
R0125:Adgra3 UTSW 5 50001852 splice site probably benign
R0137:Adgra3 UTSW 5 49963840 splice site probably benign
R0415:Adgra3 UTSW 5 49961757 splice site probably benign
R0479:Adgra3 UTSW 5 49990265 missense probably benign 0.00
R0505:Adgra3 UTSW 5 50009334 critical splice donor site probably null
R0831:Adgra3 UTSW 5 49970802 missense probably damaging 1.00
R0883:Adgra3 UTSW 5 49960723 missense probably damaging 1.00
R0920:Adgra3 UTSW 5 49961161 missense probably benign 0.19
R1139:Adgra3 UTSW 5 49961755 splice site probably null
R1211:Adgra3 UTSW 5 50006876 missense possibly damaging 0.88
R1370:Adgra3 UTSW 5 49960787 missense possibly damaging 0.56
R1530:Adgra3 UTSW 5 49961137 missense probably benign 0.00
R1703:Adgra3 UTSW 5 50006775 missense probably benign 0.00
R1782:Adgra3 UTSW 5 49972062 missense probably benign 0.02
R1843:Adgra3 UTSW 5 49961492 missense probably damaging 1.00
R2157:Adgra3 UTSW 5 50001941 missense possibly damaging 0.87
R2281:Adgra3 UTSW 5 50001880 missense probably benign 0.04
R2385:Adgra3 UTSW 5 49979566 missense possibly damaging 0.95
R2426:Adgra3 UTSW 5 50009449 missense possibly damaging 0.61
R3084:Adgra3 UTSW 5 50013391 critical splice donor site probably null
R3086:Adgra3 UTSW 5 50013391 critical splice donor site probably null
R3409:Adgra3 UTSW 5 50001930 missense probably damaging 1.00
R3410:Adgra3 UTSW 5 50001930 missense probably damaging 1.00
R3411:Adgra3 UTSW 5 50001930 missense probably damaging 1.00
R4301:Adgra3 UTSW 5 49961078 missense possibly damaging 0.94
R4360:Adgra3 UTSW 5 49990210 missense possibly damaging 0.92
R4475:Adgra3 UTSW 5 50001898 missense probably damaging 1.00
R4569:Adgra3 UTSW 5 49960563 missense probably damaging 1.00
R4607:Adgra3 UTSW 5 49970739 missense probably damaging 0.98
R4667:Adgra3 UTSW 5 49978956 missense possibly damaging 0.94
R4671:Adgra3 UTSW 5 49979368 missense probably damaging 1.00
R4886:Adgra3 UTSW 5 49999195 missense probably benign 0.07
R5197:Adgra3 UTSW 5 49960754 missense probably benign 0.01
R5208:Adgra3 UTSW 5 50011515 missense probably damaging 0.99
R5313:Adgra3 UTSW 5 49961309 missense probably benign 0.24
R5435:Adgra3 UTSW 5 49990126 missense probably damaging 0.99
R5663:Adgra3 UTSW 5 49999285 missense probably benign 0.14
R6038:Adgra3 UTSW 5 49999145 nonsense probably null
R6038:Adgra3 UTSW 5 49999145 nonsense probably null
R6064:Adgra3 UTSW 5 49960325 missense probably damaging 0.97
R6259:Adgra3 UTSW 5 49999141 missense possibly damaging 0.63
R6272:Adgra3 UTSW 5 50009449 missense possibly damaging 0.61
R6293:Adgra3 UTSW 5 49960847 missense probably benign 0.21
R6296:Adgra3 UTSW 5 49960847 missense probably benign 0.21
R6297:Adgra3 UTSW 5 49960847 missense probably benign 0.21
R6352:Adgra3 UTSW 5 49979136 missense probably benign
R6352:Adgra3 UTSW 5 49990250 missense probably benign 0.01
R6989:Adgra3 UTSW 5 50006884 missense probably damaging 1.00
R7026:Adgra3 UTSW 5 49960741 missense probably benign
R7147:Adgra3 UTSW 5 49961245 missense probably damaging 1.00
R7381:Adgra3 UTSW 5 50058774 start codon destroyed probably null
R7508:Adgra3 UTSW 5 50016867 missense probably benign 0.10
R7538:Adgra3 UTSW 5 49961450 missense probably benign 0.01
R7579:Adgra3 UTSW 5 49987635 missense probably benign
RF036:Adgra3 UTSW 5 50058641 small deletion probably benign
X0065:Adgra3 UTSW 5 49971962 missense probably benign
Predicted Primers PCR Primer
(F):5'- CACAGATTCTGGCTAGGCAC -3'
(R):5'- CCAAGCTTCCAGGACATGAC -3'

Sequencing Primer
(F):5'- TTCTGGCTAGGCACCGCAAG -3'
(R):5'- ATAGCTCCGACTGGACTGGAC -3'
Posted On2019-06-26