Incidental Mutation 'R7206:Vmn2r26'
ID 560615
Institutional Source Beutler Lab
Gene Symbol Vmn2r26
Ensembl Gene ENSMUSG00000096630
Gene Name vomeronasal 2, receptor 26
Synonyms V2r1b
MMRRC Submission 045284-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.094) question?
Stock # R7206 (G1)
Quality Score 225.009
Status Validated
Chromosome 6
Chromosomal Location 124001717-124038994 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to A at 124016727 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Methionine to Lysine at position 397 (M397K)
Ref Sequence ENSEMBL: ENSMUSP00000032238 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000032238]
AlphaFold Q6TAC4
Predicted Effect probably benign
Transcript: ENSMUST00000032238
AA Change: M397K

PolyPhen 2 Score 0.168 (Sensitivity: 0.92; Specificity: 0.87)
SMART Domains Protein: ENSMUSP00000032238
Gene: ENSMUSG00000096630
AA Change: M397K

DomainStartEndE-ValueType
signal peptide 1 22 N/A INTRINSIC
Pfam:ANF_receptor 82 471 1.5e-31 PFAM
Pfam:NCD3G 519 572 4.6e-25 PFAM
Pfam:7tm_3 603 840 1.5e-55 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 98.9%
Validation Efficiency 99% (87/88)
MGI Phenotype PHENOTYPE: Mice homozygous for a knock-out allele exhibit abnormal vomeronasal sensory neuron physiology and avnosmia. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 87 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aadacl2 G A 3: 59,932,662 (GRCm39) M392I probably benign Het
Aadacl4fm2 T A 4: 144,285,211 (GRCm39) D142V probably damaging Het
Acr T C 15: 89,458,374 (GRCm39) S352P probably benign Het
Adam6a T C 12: 113,509,654 (GRCm39) C676R probably damaging Het
Adgra3 T C 5: 50,164,238 (GRCm39) D247G probably damaging Het
Agxt2 A T 15: 10,377,542 (GRCm39) E147D probably damaging Het
Atp2a1 T C 7: 126,047,144 (GRCm39) T805A probably benign Het
Atp8b4 T C 2: 126,300,212 (GRCm39) S106G probably damaging Het
Ccdc170 T A 10: 4,464,120 (GRCm39) M87K possibly damaging Het
Ccnl2 T G 4: 155,905,431 (GRCm39) V287G possibly damaging Het
Ccr6 A T 17: 8,475,781 (GRCm39) M329L probably benign Het
Cflar G T 1: 58,780,150 (GRCm39) M248I Het
Cib4 A T 5: 30,703,110 (GRCm39) L5* probably null Het
Col27a1 A T 4: 63,153,583 (GRCm39) Y645F probably benign Het
Cxcr2 A G 1: 74,198,213 (GRCm39) T236A possibly damaging Het
Dnah12 G A 14: 26,500,869 (GRCm39) probably null Het
Dnah7a A T 1: 53,737,792 (GRCm39) L47* probably null Het
Dnajb6 A C 5: 29,986,335 (GRCm39) K301T possibly damaging Het
Dpf2 T A 19: 5,954,571 (GRCm39) I157F possibly damaging Het
Drd4 G A 7: 140,872,032 (GRCm39) G28R probably damaging Het
Dus3l A T 17: 57,074,807 (GRCm39) I310F probably damaging Het
Dusp29 A G 14: 21,727,102 (GRCm39) V182A probably damaging Het
Eef1akmt3 A G 10: 126,876,862 (GRCm39) L95P probably damaging Het
Fabp7 C T 10: 57,661,087 (GRCm39) probably benign Het
Fam135a T C 1: 24,069,354 (GRCm39) N505S probably benign Het
Fam216b C A 14: 78,322,567 (GRCm39) D46Y probably damaging Het
Gata6 C T 18: 11,054,850 (GRCm39) R260C probably damaging Het
Gm10800 A AC 2: 98,497,378 (GRCm39) probably null Het
Golgb1 A G 16: 36,734,111 (GRCm39) I1160M probably benign Het
Hjv A T 3: 96,435,444 (GRCm39) D234V probably damaging Het
Kiss1 A G 1: 133,255,063 (GRCm39) K26E probably benign Het
Knl1 T A 2: 118,899,780 (GRCm39) F494I probably benign Het
Ktn1 T C 14: 47,932,985 (GRCm39) L713S probably damaging Het
Loxhd1 A G 18: 77,529,513 (GRCm39) D2052G probably damaging Het
Lpo A C 11: 87,698,249 (GRCm39) L582R probably damaging Het
Map2k3 A G 11: 60,834,406 (GRCm39) T125A Het
Matn3 T A 12: 9,011,170 (GRCm39) N360K probably benign Het
Mlip A T 9: 77,072,144 (GRCm39) V237E probably damaging Het
Mms22l T C 4: 24,591,146 (GRCm39) V999A probably benign Het
Mn1 A G 5: 111,568,378 (GRCm39) K783E possibly damaging Het
Myo1h A T 5: 114,457,836 (GRCm39) K132* probably null Het
Nle1 A G 11: 82,795,757 (GRCm39) V230A probably benign Het
Or1ak2 T A 2: 36,827,784 (GRCm39) Y218N probably damaging Het
Or1e1b-ps1 A T 11: 73,845,647 (GRCm39) I44F probably benign Het
Or4a68 T C 2: 89,270,801 (GRCm39) probably benign Het
Or4f62 T G 2: 111,986,804 (GRCm39) C169W probably damaging Het
Or51f23 T C 7: 102,452,891 (GRCm39) S69P probably damaging Het
Or7e169 C T 9: 19,757,856 (GRCm39) D20N probably damaging Het
Ormdl2 T A 10: 128,656,284 (GRCm39) H7L possibly damaging Het
Pam A G 1: 97,823,757 (GRCm39) S225P probably damaging Het
Pan2 C A 10: 128,150,414 (GRCm39) Y719* probably null Het
Ppfia4 T C 1: 134,255,127 (GRCm39) S243G probably benign Het
Ppig T G 2: 69,571,910 (GRCm39) S210A unknown Het
Ppwd1 A T 13: 104,350,106 (GRCm39) N426K probably damaging Het
Prxl2a T A 14: 40,726,142 (GRCm39) M12L probably benign Het
Rnf10 T G 5: 115,382,180 (GRCm39) D675A probably benign Het
Rrp12 A T 19: 41,866,478 (GRCm39) L619H probably damaging Het
Rsph10b C T 5: 143,898,010 (GRCm39) T497I possibly damaging Het
Scnm1 A T 3: 95,041,205 (GRCm39) M1K probably null Het
Scp2 G T 4: 107,931,638 (GRCm39) D332E probably benign Het
Senp3 T C 11: 69,569,557 (GRCm39) I314V probably benign Het
Sfmbt1 T A 14: 30,533,330 (GRCm39) probably null Het
Slc44a2 T C 9: 21,258,103 (GRCm39) F451S probably damaging Het
Slfn1 A T 11: 83,012,837 (GRCm39) M318L probably benign Het
Syne2 C T 12: 76,051,531 (GRCm39) S4087L probably benign Het
Syt7 A G 19: 10,395,337 (GRCm39) Y49C probably damaging Het
Tas2r134 T C 2: 51,518,120 (GRCm39) Y200H probably benign Het
Tgfbr1 A T 4: 47,402,941 (GRCm39) H315L probably damaging Het
Tmem184c A G 8: 78,323,206 (GRCm39) V552A possibly damaging Het
Tnxb A G 17: 34,923,075 (GRCm39) R2553G possibly damaging Het
Tomm40 C G 7: 19,444,861 (GRCm39) R173S probably benign Het
Tonsl T C 15: 76,517,851 (GRCm39) D650G probably damaging Het
Tpo G C 12: 30,153,133 (GRCm39) S407W possibly damaging Het
Trank1 T C 9: 111,174,583 (GRCm39) probably null Het
Trp53tg5 T C 2: 164,313,378 (GRCm39) E99G probably damaging Het
Tubb2a C A 13: 34,259,505 (GRCm39) S95I possibly damaging Het
Vav2 C A 2: 27,226,731 (GRCm39) R114L probably benign Het
Vmn1r172 A T 7: 23,359,582 (GRCm39) I156L possibly damaging Het
Vmn1r238 A G 18: 3,122,623 (GRCm39) Y264H possibly damaging Het
Vmn2r73 T C 7: 85,522,075 (GRCm39) N88S probably benign Het
Vps13a T C 19: 16,731,662 (GRCm39) N150S probably damaging Het
Vps35 A T 8: 86,014,350 (GRCm39) Y100N probably damaging Het
Vps8 A C 16: 21,276,171 (GRCm39) I235L probably damaging Het
Yipf2 T A 9: 21,501,657 (GRCm39) H157L probably damaging Het
Zfp354a A T 11: 50,961,073 (GRCm39) H426L probably damaging Het
Zfp503 G T 14: 22,035,553 (GRCm39) S454R possibly damaging Het
Zfp619 C T 7: 39,184,824 (GRCm39) R285C probably benign Het
Other mutations in Vmn2r26
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01070:Vmn2r26 APN 6 124,038,566 (GRCm39) missense probably benign 0.00
IGL01370:Vmn2r26 APN 6 124,038,715 (GRCm39) missense probably benign 0.08
IGL01603:Vmn2r26 APN 6 124,030,833 (GRCm39) missense probably damaging 1.00
IGL01651:Vmn2r26 APN 6 124,027,632 (GRCm39) missense probably benign 0.01
IGL02282:Vmn2r26 APN 6 124,038,584 (GRCm39) missense probably damaging 1.00
IGL02425:Vmn2r26 APN 6 124,038,777 (GRCm39) missense probably damaging 1.00
IGL02551:Vmn2r26 APN 6 124,003,100 (GRCm39) missense probably benign 0.11
IGL02690:Vmn2r26 APN 6 124,003,091 (GRCm39) missense probably benign 0.14
IGL03002:Vmn2r26 APN 6 124,016,754 (GRCm39) missense possibly damaging 0.78
IGL03270:Vmn2r26 APN 6 124,027,778 (GRCm39) missense probably benign 0.16
R0032:Vmn2r26 UTSW 6 124,016,858 (GRCm39) missense possibly damaging 0.72
R0052:Vmn2r26 UTSW 6 124,038,992 (GRCm39) makesense probably null
R0083:Vmn2r26 UTSW 6 124,030,940 (GRCm39) splice site probably null
R0682:Vmn2r26 UTSW 6 124,038,129 (GRCm39) missense probably damaging 0.97
R1061:Vmn2r26 UTSW 6 124,038,603 (GRCm39) missense probably benign 0.12
R1077:Vmn2r26 UTSW 6 124,030,872 (GRCm39) missense probably benign 0.00
R1263:Vmn2r26 UTSW 6 124,027,667 (GRCm39) missense probably benign
R1579:Vmn2r26 UTSW 6 124,016,706 (GRCm39) missense probably benign 0.00
R1741:Vmn2r26 UTSW 6 124,038,431 (GRCm39) missense probably damaging 1.00
R1834:Vmn2r26 UTSW 6 124,038,369 (GRCm39) missense possibly damaging 0.54
R1838:Vmn2r26 UTSW 6 124,001,730 (GRCm39) missense probably benign
R1956:Vmn2r26 UTSW 6 124,030,846 (GRCm39) missense probably damaging 1.00
R1996:Vmn2r26 UTSW 6 124,038,144 (GRCm39) missense probably damaging 1.00
R2140:Vmn2r26 UTSW 6 124,038,196 (GRCm39) missense probably benign 0.01
R2327:Vmn2r26 UTSW 6 124,016,708 (GRCm39) missense probably benign 0.07
R2417:Vmn2r26 UTSW 6 124,038,309 (GRCm39) missense probably damaging 1.00
R3930:Vmn2r26 UTSW 6 124,002,938 (GRCm39) missense probably benign
R4490:Vmn2r26 UTSW 6 124,027,697 (GRCm39) missense possibly damaging 0.47
R4629:Vmn2r26 UTSW 6 124,038,150 (GRCm39) missense possibly damaging 0.50
R4655:Vmn2r26 UTSW 6 124,038,375 (GRCm39) missense probably damaging 1.00
R4709:Vmn2r26 UTSW 6 124,030,924 (GRCm39) missense probably damaging 1.00
R4992:Vmn2r26 UTSW 6 124,003,070 (GRCm39) missense probably benign 0.00
R5297:Vmn2r26 UTSW 6 124,038,832 (GRCm39) missense probably damaging 1.00
R5482:Vmn2r26 UTSW 6 124,038,285 (GRCm39) missense possibly damaging 0.88
R5517:Vmn2r26 UTSW 6 124,027,676 (GRCm39) missense probably damaging 1.00
R5737:Vmn2r26 UTSW 6 124,016,408 (GRCm39) missense probably benign 0.00
R5739:Vmn2r26 UTSW 6 124,002,925 (GRCm39) missense probably benign 0.00
R5873:Vmn2r26 UTSW 6 124,038,633 (GRCm39) missense probably benign 0.01
R5907:Vmn2r26 UTSW 6 124,016,830 (GRCm39) missense probably benign 0.00
R6086:Vmn2r26 UTSW 6 124,016,519 (GRCm39) missense possibly damaging 0.48
R6134:Vmn2r26 UTSW 6 124,038,444 (GRCm39) missense probably damaging 0.97
R6391:Vmn2r26 UTSW 6 124,038,348 (GRCm39) missense probably damaging 1.00
R6428:Vmn2r26 UTSW 6 124,003,039 (GRCm39) missense probably benign 0.17
R6637:Vmn2r26 UTSW 6 124,038,650 (GRCm39) missense probably damaging 1.00
R6927:Vmn2r26 UTSW 6 124,016,057 (GRCm39) missense possibly damaging 0.93
R6953:Vmn2r26 UTSW 6 124,016,741 (GRCm39) missense probably benign 0.00
R7173:Vmn2r26 UTSW 6 124,038,255 (GRCm39) missense probably benign 0.16
R7208:Vmn2r26 UTSW 6 124,038,948 (GRCm39) missense probably damaging 1.00
R7283:Vmn2r26 UTSW 6 124,002,914 (GRCm39) missense probably damaging 0.97
R7506:Vmn2r26 UTSW 6 124,016,700 (GRCm39) missense probably benign 0.00
R7672:Vmn2r26 UTSW 6 124,016,606 (GRCm39) missense probably benign 0.25
R7674:Vmn2r26 UTSW 6 124,016,321 (GRCm39) missense probably benign
R7696:Vmn2r26 UTSW 6 124,038,494 (GRCm39) missense possibly damaging 0.94
R7716:Vmn2r26 UTSW 6 124,038,704 (GRCm39) missense probably damaging 1.00
R7831:Vmn2r26 UTSW 6 124,016,758 (GRCm39) nonsense probably null
R8063:Vmn2r26 UTSW 6 124,001,914 (GRCm39) missense probably benign 0.00
R8331:Vmn2r26 UTSW 6 124,038,887 (GRCm39) missense probably benign 0.22
R8352:Vmn2r26 UTSW 6 124,016,577 (GRCm39) missense probably benign 0.09
R8445:Vmn2r26 UTSW 6 124,002,995 (GRCm39) missense probably damaging 0.97
R8452:Vmn2r26 UTSW 6 124,016,577 (GRCm39) missense probably benign 0.09
R8681:Vmn2r26 UTSW 6 124,001,877 (GRCm39) missense probably benign 0.00
R8914:Vmn2r26 UTSW 6 124,038,983 (GRCm39) missense probably benign
R9333:Vmn2r26 UTSW 6 124,003,009 (GRCm39) missense probably benign 0.13
R9351:Vmn2r26 UTSW 6 124,016,333 (GRCm39) missense probably benign
R9436:Vmn2r26 UTSW 6 124,002,826 (GRCm39) missense probably damaging 1.00
R9515:Vmn2r26 UTSW 6 124,038,137 (GRCm39) missense probably damaging 1.00
RF010:Vmn2r26 UTSW 6 124,016,448 (GRCm39) missense possibly damaging 0.90
Predicted Primers PCR Primer
(F):5'- ACACACTTTGGTGGAGGATTATC -3'
(R):5'- AAGCCAGAGTCAAACAGCTTAG -3'

Sequencing Primer
(F):5'- CTGGGATTCAAGGATTTTCTCAGAAG -3'
(R):5'- CCAGAGTCAAACAGCTTAGAAAAAG -3'
Posted On 2019-06-26