Incidental Mutation 'R7206:Trank1'
ID560630
Institutional Source Beutler Lab
Gene Symbol Trank1
Ensembl Gene ENSMUSG00000062296
Gene Nametetratricopeptide repeat and ankyrin repeat containing 1
SynonymsA230061D21Rik, LOC235639, C030048J01Rik, Lba1
MMRRC Submission
Accession Numbers

Genbank: NM_001164659.1; Ensembl: ENSMUST00000078626

Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R7206 (G1)
Quality Score225.009
Status Validated
Chromosome9
Chromosomal Location111311739-111395775 bp(+) (GRCm38)
Type of Mutationcritical splice donor site (2 bp from exon)
DNA Base Change (assembly) T to C at 111345515 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000077697 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000078626] [ENSMUST00000197049]
Predicted Effect probably null
Transcript: ENSMUST00000078626
SMART Domains Protein: ENSMUSP00000077697
Gene: ENSMUSG00000062296

DomainStartEndE-ValueType
low complexity region 4 30 N/A INTRINSIC
low complexity region 34 52 N/A INTRINSIC
low complexity region 113 129 N/A INTRINSIC
Blast:TPR 144 177 1e-15 BLAST
Blast:TPR 178 209 8e-13 BLAST
Blast:ANK 332 361 1e-6 BLAST
ANK 369 405 5.29e0 SMART
ANK 538 567 2.11e2 SMART
ANK 572 609 7.29e2 SMART
ANK 621 652 1.21e2 SMART
low complexity region 887 895 N/A INTRINSIC
low complexity region 1152 1172 N/A INTRINSIC
Blast:AAA 1351 1569 1e-6 BLAST
low complexity region 2166 2177 N/A INTRINSIC
low complexity region 2395 2411 N/A INTRINSIC
low complexity region 2636 2649 N/A INTRINSIC
low complexity region 2966 2983 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000197049
SMART Domains Protein: ENSMUSP00000143534
Gene: ENSMUSG00000062296

DomainStartEndE-ValueType
Blast:TPR 15 48 3e-17 BLAST
SCOP:d1ihga1 15 84 8e-10 SMART
Blast:TPR 49 82 4e-14 BLAST
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 98.9%
Validation Efficiency 99% (87/88)
Allele List at MGI

All alleles(2) : Targeted, other(2)

Other mutations in this stock
Total: 87 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aadacl2 G A 3: 60,025,241 M392I probably benign Het
Acr T C 15: 89,574,171 S352P probably benign Het
Adam6a T C 12: 113,546,034 C676R probably damaging Het
Adgra3 T C 5: 50,006,896 D247G probably damaging Het
Agxt2 A T 15: 10,377,456 E147D probably damaging Het
Atp2a1 T C 7: 126,447,972 T805A probably benign Het
Atp8b4 T C 2: 126,458,292 S106G probably damaging Het
Ccdc170 T A 10: 4,514,120 M87K possibly damaging Het
Ccnl2 T G 4: 155,820,974 V287G possibly damaging Het
Ccr6 A T 17: 8,256,949 M329L probably benign Het
Cflar G T 1: 58,740,991 M248I Het
Cib4 A T 5: 30,545,766 L5* probably null Het
Col27a1 A T 4: 63,235,346 Y645F probably benign Het
Cxcr2 A G 1: 74,159,054 T236A possibly damaging Het
Dnah12 G A 14: 26,778,912 probably null Het
Dnah7a A T 1: 53,698,633 L47* probably null Het
Dnajb6 A C 5: 29,781,337 K301T possibly damaging Het
Dpf2 T A 19: 5,904,543 I157F possibly damaging Het
Drd4 G A 7: 141,292,119 G28R probably damaging Het
Dupd1 A G 14: 21,677,034 V182A probably damaging Het
Dus3l A T 17: 56,767,807 I310F probably damaging Het
Eef1akmt3 A G 10: 127,040,993 L95P probably damaging Het
Fabp7 C T 10: 57,784,991 probably benign Het
Fam135a T C 1: 24,030,273 N505S probably benign Het
Fam213a T A 14: 41,004,185 M12L probably benign Het
Fam216b C A 14: 78,085,127 D46Y probably damaging Het
Gata6 C T 18: 11,054,850 R260C probably damaging Het
Gm10800 A AC 2: 98,667,033 probably null Het
Gm13124 T A 4: 144,558,641 D142V probably damaging Het
Golgb1 A G 16: 36,913,749 I1160M probably benign Het
Hfe2 A T 3: 96,528,128 D234V probably damaging Het
Kiss1 A G 1: 133,327,325 K26E probably benign Het
Knl1 T A 2: 119,069,299 F494I probably benign Het
Ktn1 T C 14: 47,695,528 L713S probably damaging Het
Loxhd1 A G 18: 77,441,817 D2052G probably damaging Het
Lpo A C 11: 87,807,423 L582R probably damaging Het
Map2k3 A G 11: 60,943,580 T125A Het
Matn3 T A 12: 8,961,170 N360K probably benign Het
Mlip A T 9: 77,164,862 V237E probably damaging Het
Mms22l T C 4: 24,591,146 V999A probably benign Het
Mn1 A G 5: 111,420,512 K783E possibly damaging Het
Myo1h A T 5: 114,319,775 K132* probably null Het
Nle1 A G 11: 82,904,931 V230A probably benign Het
Olfr1240 T C 2: 89,440,457 probably benign Het
Olfr1318 T G 2: 112,156,459 C169W probably damaging Het
Olfr22-ps1 A T 11: 73,954,821 I44F probably benign Het
Olfr356 T A 2: 36,937,772 Y218N probably damaging Het
Olfr564 T C 7: 102,803,684 S69P probably damaging Het
Olfr860 C T 9: 19,846,560 D20N probably damaging Het
Ormdl2 T A 10: 128,820,415 H7L possibly damaging Het
Pam A G 1: 97,896,032 S225P probably damaging Het
Pan2 C A 10: 128,314,545 Y719* probably null Het
Ppfia4 T C 1: 134,327,389 S243G probably benign Het
Ppig T G 2: 69,741,566 S210A unknown Het
Ppwd1 A T 13: 104,213,598 N426K probably damaging Het
Rnf10 T G 5: 115,244,121 D675A probably benign Het
Rrp12 A T 19: 41,878,039 L619H probably damaging Het
Rsph10b C T 5: 143,961,192 T497I possibly damaging Het
Scnm1 A T 3: 95,133,894 M1K probably null Het
Scp2 G T 4: 108,074,441 D332E probably benign Het
Senp3 T C 11: 69,678,731 I314V probably benign Het
Sfmbt1 T A 14: 30,811,373 probably null Het
Slc44a2 T C 9: 21,346,807 F451S probably damaging Het
Slfn1 A T 11: 83,122,011 M318L probably benign Het
Syne2 C T 12: 76,004,757 S4087L probably benign Het
Syt7 A G 19: 10,417,973 Y49C probably damaging Het
Tas2r134 T C 2: 51,628,108 Y200H probably benign Het
Tgfbr1 A T 4: 47,402,941 H315L probably damaging Het
Tmem184c A G 8: 77,596,577 V552A possibly damaging Het
Tnxb A G 17: 34,704,101 R2553G possibly damaging Het
Tomm40 C G 7: 19,710,936 R173S probably benign Het
Tonsl T C 15: 76,633,651 D650G probably damaging Het
Tpo G C 12: 30,103,134 S407W possibly damaging Het
Trp53tg5 T C 2: 164,471,458 E99G probably damaging Het
Tubb2a C A 13: 34,075,522 S95I possibly damaging Het
Vav2 C A 2: 27,336,719 R114L probably benign Het
Vmn1r172 A T 7: 23,660,157 I156L possibly damaging Het
Vmn1r238 A G 18: 3,122,623 Y264H possibly damaging Het
Vmn2r26 T A 6: 124,039,768 M397K probably benign Het
Vmn2r73 T C 7: 85,872,867 N88S probably benign Het
Vps13a T C 19: 16,754,298 N150S probably damaging Het
Vps35 A T 8: 85,287,721 Y100N probably damaging Het
Vps8 A C 16: 21,457,421 I235L probably damaging Het
Yipf2 T A 9: 21,590,361 H157L probably damaging Het
Zfp354a A T 11: 51,070,246 H426L probably damaging Het
Zfp503 G T 14: 21,985,485 S454R possibly damaging Het
Zfp619 C T 7: 39,535,400 R285C probably benign Het
Other mutations in Trank1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00234:Trank1 APN 9 111392609 missense probably damaging 1.00
IGL00467:Trank1 APN 9 111364666 splice site probably benign
IGL00569:Trank1 APN 9 111345511 missense possibly damaging 0.69
IGL00585:Trank1 APN 9 111349290 missense possibly damaging 0.82
IGL01070:Trank1 APN 9 111366793 missense probably damaging 1.00
IGL01134:Trank1 APN 9 111391781 missense probably benign
IGL01154:Trank1 APN 9 111386400 missense probably benign 0.00
IGL01355:Trank1 APN 9 111365520 missense possibly damaging 0.94
IGL01407:Trank1 APN 9 111364722 missense probably damaging 0.99
IGL01410:Trank1 APN 9 111365049 missense probably benign 0.00
IGL01410:Trank1 APN 9 111365259 missense probably benign 0.00
IGL01504:Trank1 APN 9 111373544 missense probably damaging 1.00
IGL01744:Trank1 APN 9 111349363 missense probably damaging 1.00
IGL02043:Trank1 APN 9 111363960 missense probably damaging 0.98
IGL02104:Trank1 APN 9 111390712 missense possibly damaging 0.85
IGL02193:Trank1 APN 9 111367276 missense probably benign 0.43
IGL02581:Trank1 APN 9 111383125 missense probably benign 0.00
IGL02630:Trank1 APN 9 111373075 missense possibly damaging 0.70
IGL02839:Trank1 APN 9 111364756 missense probably damaging 1.00
IGL02897:Trank1 APN 9 111367517 missense probably damaging 0.99
IGL03065:Trank1 APN 9 111390293 missense possibly damaging 0.64
IGL03123:Trank1 APN 9 111367407 missense probably damaging 1.00
IGL03143:Trank1 APN 9 111366087 missense probably damaging 1.00
IGL03323:Trank1 APN 9 111352116 missense probably damaging 1.00
1mM(1):Trank1 UTSW 9 111392981 missense probably damaging 1.00
PIT4486001:Trank1 UTSW 9 111390107 missense probably damaging 1.00
PIT4812001:Trank1 UTSW 9 111347912 missense probably damaging 1.00
R0035:Trank1 UTSW 9 111366776 missense probably benign 0.00
R0064:Trank1 UTSW 9 111343195 missense probably damaging 1.00
R0064:Trank1 UTSW 9 111343195 missense probably damaging 1.00
R0089:Trank1 UTSW 9 111392910 missense probably benign 0.00
R0207:Trank1 UTSW 9 111366253 missense probably damaging 1.00
R0255:Trank1 UTSW 9 111366024 missense possibly damaging 0.92
R0334:Trank1 UTSW 9 111365353 missense probably benign 0.00
R0334:Trank1 UTSW 9 111392940 missense probably damaging 1.00
R0383:Trank1 UTSW 9 111391477 missense probably benign 0.08
R0421:Trank1 UTSW 9 111391839 missense probably damaging 1.00
R0494:Trank1 UTSW 9 111391293 missense probably benign 0.19
R0518:Trank1 UTSW 9 111333808 missense probably damaging 1.00
R0560:Trank1 UTSW 9 111391086 missense possibly damaging 0.88
R0637:Trank1 UTSW 9 111390441 missense probably damaging 1.00
R0731:Trank1 UTSW 9 111365488 missense probably damaging 1.00
R0761:Trank1 UTSW 9 111366613 missense probably damaging 1.00
R0766:Trank1 UTSW 9 111347469 missense probably benign 0.45
R0827:Trank1 UTSW 9 111349417 unclassified probably benign
R1005:Trank1 UTSW 9 111333721 missense probably benign 0.13
R1108:Trank1 UTSW 9 111365307 missense probably benign 0.00
R1155:Trank1 UTSW 9 111366970 missense possibly damaging 0.95
R1470:Trank1 UTSW 9 111343232 missense possibly damaging 0.91
R1470:Trank1 UTSW 9 111343232 missense possibly damaging 0.91
R1596:Trank1 UTSW 9 111366290 missense possibly damaging 0.93
R1601:Trank1 UTSW 9 111373477 missense probably damaging 1.00
R1751:Trank1 UTSW 9 111391479 missense probably benign
R1754:Trank1 UTSW 9 111392871 missense probably benign 0.00
R1767:Trank1 UTSW 9 111391479 missense probably benign
R1768:Trank1 UTSW 9 111392927 missense probably damaging 0.96
R1809:Trank1 UTSW 9 111392825 missense probably benign 0.34
R1912:Trank1 UTSW 9 111390709 missense probably benign 0.00
R1920:Trank1 UTSW 9 111347928 critical splice donor site probably null
R1960:Trank1 UTSW 9 111391628 missense probably damaging 1.00
R1993:Trank1 UTSW 9 111378832 missense probably benign 0.20
R2012:Trank1 UTSW 9 111365028 missense probably benign
R2025:Trank1 UTSW 9 111392039 missense probably benign 0.01
R2050:Trank1 UTSW 9 111364788 missense probably damaging 1.00
R2857:Trank1 UTSW 9 111366933 missense probably benign 0.00
R2912:Trank1 UTSW 9 111392483 missense probably damaging 0.98
R2962:Trank1 UTSW 9 111352080 missense probably damaging 1.00
R3030:Trank1 UTSW 9 111391530 missense possibly damaging 0.63
R3821:Trank1 UTSW 9 111378819 missense probably damaging 1.00
R3822:Trank1 UTSW 9 111378819 missense probably damaging 1.00
R3892:Trank1 UTSW 9 111364759 missense probably benign 0.03
R4105:Trank1 UTSW 9 111352197 missense probably damaging 1.00
R4166:Trank1 UTSW 9 111373524 nonsense probably null
R4237:Trank1 UTSW 9 111367035 missense probably benign 0.04
R4239:Trank1 UTSW 9 111367035 missense probably benign 0.04
R4394:Trank1 UTSW 9 111365197 missense possibly damaging 0.86
R4417:Trank1 UTSW 9 111365968 missense probably benign 0.17
R4611:Trank1 UTSW 9 111362261 missense probably damaging 1.00
R4694:Trank1 UTSW 9 111392061 missense probably benign 0.40
R4731:Trank1 UTSW 9 111390410 missense probably damaging 1.00
R4843:Trank1 UTSW 9 111366078 missense probably benign 0.00
R4852:Trank1 UTSW 9 111391895 missense possibly damaging 0.68
R4859:Trank1 UTSW 9 111365010 missense probably benign 0.17
R4868:Trank1 UTSW 9 111365641 missense probably damaging 1.00
R5080:Trank1 UTSW 9 111389221 missense probably damaging 0.99
R5156:Trank1 UTSW 9 111390694 missense probably damaging 1.00
R5174:Trank1 UTSW 9 111365559 missense probably benign 0.00
R5234:Trank1 UTSW 9 111386467 missense probably damaging 1.00
R5386:Trank1 UTSW 9 111362402 missense probably benign 0.12
R5419:Trank1 UTSW 9 111391301 missense probably damaging 1.00
R5435:Trank1 UTSW 9 111391890 missense probably benign 0.00
R5444:Trank1 UTSW 9 111392958 missense probably benign 0.04
R5543:Trank1 UTSW 9 111366112 missense probably damaging 0.97
R5560:Trank1 UTSW 9 111390567 missense probably damaging 1.00
R5772:Trank1 UTSW 9 111366676 missense possibly damaging 0.86
R5774:Trank1 UTSW 9 111391226 missense probably damaging 1.00
R5843:Trank1 UTSW 9 111365860 missense possibly damaging 0.59
R5858:Trank1 UTSW 9 111392536 missense probably benign
R5878:Trank1 UTSW 9 111366685 missense possibly damaging 0.93
R5900:Trank1 UTSW 9 111391716 missense probably damaging 1.00
R5917:Trank1 UTSW 9 111362417 missense probably benign 0.38
R5954:Trank1 UTSW 9 111365133 missense probably benign 0.13
R6041:Trank1 UTSW 9 111377796 missense possibly damaging 0.94
R6112:Trank1 UTSW 9 111391737 missense probably damaging 1.00
R6165:Trank1 UTSW 9 111391872 missense probably benign 0.00
R6255:Trank1 UTSW 9 111352246 critical splice donor site probably null
R6395:Trank1 UTSW 9 111367200 missense probably damaging 1.00
R6567:Trank1 UTSW 9 111347521 missense probably benign 0.02
R6644:Trank1 UTSW 9 111364834 missense possibly damaging 0.85
R6724:Trank1 UTSW 9 111365916 missense probably damaging 1.00
R6788:Trank1 UTSW 9 111390679 missense probably damaging 1.00
R6831:Trank1 UTSW 9 111377899 missense probably benign 0.00
R6934:Trank1 UTSW 9 111373090 missense probably damaging 0.99
R7127:Trank1 UTSW 9 111365796 missense possibly damaging 0.85
R7236:Trank1 UTSW 9 111373074 missense possibly damaging 0.93
R7247:Trank1 UTSW 9 111367512 missense probably damaging 1.00
R7292:Trank1 UTSW 9 111377870 missense probably benign 0.02
R7310:Trank1 UTSW 9 111367126 missense probably damaging 1.00
R7431:Trank1 UTSW 9 111362402 missense probably benign 0.12
R7448:Trank1 UTSW 9 111366349 missense probably benign 0.01
R7477:Trank1 UTSW 9 111364957 missense probably benign 0.00
R7514:Trank1 UTSW 9 111364756 missense probably damaging 1.00
R7595:Trank1 UTSW 9 111365991 missense probably damaging 1.00
R7637:Trank1 UTSW 9 111365296 missense possibly damaging 0.71
R7648:Trank1 UTSW 9 111391685 missense probably benign
R7737:Trank1 UTSW 9 111366012 nonsense probably null
R7784:Trank1 UTSW 9 111364103 missense probably damaging 1.00
R7884:Trank1 UTSW 9 111392516 missense probably benign
R7912:Trank1 UTSW 9 111391528 missense probably benign 0.04
R7938:Trank1 UTSW 9 111365028 missense probably benign
R7979:Trank1 UTSW 9 111377899 missense probably benign 0.00
R8064:Trank1 UTSW 9 111352076 nonsense probably null
R8100:Trank1 UTSW 9 111392793 missense probably damaging 1.00
R8124:Trank1 UTSW 9 111378927 missense probably benign 0.31
R8198:Trank1 UTSW 9 111390812 missense probably benign 0.09
R8219:Trank1 UTSW 9 111364909 missense probably damaging 1.00
R8223:Trank1 UTSW 9 111365889 missense probably damaging 1.00
R8316:Trank1 UTSW 9 111349302 missense probably benign 0.38
R8347:Trank1 UTSW 9 111367249 missense probably damaging 1.00
X0064:Trank1 UTSW 9 111343236 missense possibly damaging 0.57
Z1088:Trank1 UTSW 9 111364710 missense probably damaging 0.99
Z1177:Trank1 UTSW 9 111311902 missense unknown
Z1177:Trank1 UTSW 9 111367377 missense possibly damaging 0.83
Z1177:Trank1 UTSW 9 111392870 missense possibly damaging 0.47
Predicted Primers PCR Primer
(F):5'- GGAGTCGTTCTTCAGGCTTC -3'
(R):5'- AGCCCTAGTTGTCCTCAAAC -3'

Sequencing Primer
(F):5'- AGGCTTCCCTCACTTGAAAG -3'
(R):5'- GTTGTCCTCAAACTCAGAAATCTGC -3'
Posted On2019-06-26