Incidental Mutation 'R0593:Slc22a14'
ID56064
Institutional Source Beutler Lab
Gene Symbol Slc22a14
Ensembl Gene ENSMUSG00000070280
Gene Namesolute carrier family 22 (organic cation transporter), member 14
SynonymsLOC382113
MMRRC Submission 038783-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.055) question?
Stock #R0593 (G1)
Quality Score191
Status Validated
Chromosome9
Chromosomal Location119169455-119365553 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 119169851 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Valine at position 561 (D561V)
Ref Sequence ENSEMBL: ENSMUSP00000131982 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000093775] [ENSMUST00000170400]
Predicted Effect probably benign
Transcript: ENSMUST00000093775
AA Change: D561V

PolyPhen 2 Score 0.148 (Sensitivity: 0.92; Specificity: 0.87)
SMART Domains Protein: ENSMUSP00000091289
Gene: ENSMUSG00000070280
AA Change: D561V

DomainStartEndE-ValueType
transmembrane domain 68 90 N/A INTRINSIC
Pfam:Sugar_tr 156 556 1.3e-28 PFAM
Pfam:MFS_1 178 514 7.8e-28 PFAM
Predicted Effect unknown
Transcript: ENSMUST00000152061
AA Change: D135V
SMART Domains Protein: ENSMUSP00000117967
Gene: ENSMUSG00000070280
AA Change: D135V

DomainStartEndE-ValueType
transmembrane domain 73 92 N/A INTRINSIC
transmembrane domain 99 118 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000170400
AA Change: D561V

PolyPhen 2 Score 0.148 (Sensitivity: 0.92; Specificity: 0.87)
SMART Domains Protein: ENSMUSP00000131982
Gene: ENSMUSG00000070280
AA Change: D561V

DomainStartEndE-ValueType
transmembrane domain 68 90 N/A INTRINSIC
Pfam:Sugar_tr 150 555 1.2e-28 PFAM
Pfam:MFS_1 178 514 7.6e-28 PFAM
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 96.9%
  • 20x: 93.4%
Validation Efficiency 100% (39/39)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the organic-cation transporter family. It is located in a gene cluster with another member of the family, organic cation transporter like 3. The encoded protein is a transmembrane protein which is thought to transport small molecules and since this protein is conserved among several species, it is suggested to have a fundamental role in mammalian systems. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Feb 2016]
Allele List at MGI
Other mutations in this stock
Total: 33 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca8a T C 11: 110,068,099 D733G probably damaging Het
Acmsd T C 1: 127,738,603 probably benign Het
Adam34 T C 8: 43,651,687 Y307C possibly damaging Het
Alox12e A G 11: 70,320,897 probably benign Het
Ankrd50 C A 3: 38,483,007 G29* probably null Het
Arhgap17 T C 7: 123,286,743 probably benign Het
Asah1 A G 8: 41,349,582 M141T probably benign Het
Atg2a GCCTTCCTTCCTTCCTTCCTTCCTTCCTTCCTTCC GCCTTCCTTCCTTCCTTCCTTCCTTCCTTCCTTCCTTCC 19: 6,245,007 probably benign Het
Bsn A T 9: 108,110,306 I2749N unknown Het
Cds2 G A 2: 132,297,376 probably benign Het
Ckmt2 A G 13: 91,853,638 V384A probably damaging Het
Clock A G 5: 76,265,836 S71P probably benign Het
Cops6 A G 5: 138,163,580 T96A probably benign Het
Csnka2ip A T 16: 64,478,612 V19D probably damaging Het
Dcaf17 T A 2: 71,087,400 probably null Het
Dscam T C 16: 96,772,408 K785E probably benign Het
Eif2d T A 1: 131,155,728 probably benign Het
Gal3st2b T C 1: 93,940,827 V258A probably benign Het
Gucy2c T C 6: 136,728,335 N534S probably damaging Het
Hook1 C T 4: 95,998,786 T210I possibly damaging Het
Ifi203 T C 1: 173,928,649 probably benign Het
Irf7 T C 7: 141,265,062 probably benign Het
Lrp2 C T 2: 69,467,006 V3204I probably benign Het
Mtx2 A G 2: 74,869,436 probably benign Het
Nelfcd G T 2: 174,423,430 V248L probably benign Het
Olfr1349 T A 7: 6,514,809 N207Y probably benign Het
Oosp1 T C 19: 11,668,412 S121G probably benign Het
Sec16b G C 1: 157,532,148 G164R probably benign Het
Tet2 G A 3: 133,488,109 T188I probably benign Het
Tex10 C T 4: 48,456,800 R637Q probably benign Het
Trp53bp1 A G 2: 121,270,528 V63A possibly damaging Het
Ube2d2a T G 18: 35,770,385 probably benign Het
Vmn1r113 T A 7: 20,787,463 V60E probably damaging Het
Other mutations in Slc22a14
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00338:Slc22a14 APN 9 119178513 missense possibly damaging 0.58
R0086:Slc22a14 UTSW 9 119222738 critical splice donor site probably benign
R0505:Slc22a14 UTSW 9 119172034 splice site probably benign
R0597:Slc22a14 UTSW 9 119172124 missense probably damaging 0.99
R0674:Slc22a14 UTSW 9 119178542 missense probably damaging 1.00
R1290:Slc22a14 UTSW 9 119178452 missense probably damaging 1.00
R1459:Slc22a14 UTSW 9 119223761 missense possibly damaging 0.70
R1706:Slc22a14 UTSW 9 119180984 missense probably benign 0.06
R3980:Slc22a14 UTSW 9 119178486 missense probably benign 0.02
R4166:Slc22a14 UTSW 9 119178432 missense probably benign 0.00
R4166:Slc22a14 UTSW 9 119179868 missense possibly damaging 0.53
R4574:Slc22a14 UTSW 9 119179495 missense probably damaging 0.99
R4959:Slc22a14 UTSW 9 119174035 small deletion probably benign
R4973:Slc22a14 UTSW 9 119174035 small deletion probably benign
R5273:Slc22a14 UTSW 9 119170638 missense probably benign 0.08
R5330:Slc22a14 UTSW 9 119230596 missense probably damaging 1.00
R5331:Slc22a14 UTSW 9 119230596 missense probably damaging 1.00
R5543:Slc22a14 UTSW 9 119173608 missense probably benign 0.01
R5801:Slc22a14 UTSW 9 119172083 missense probably benign 0.01
R6521:Slc22a14 UTSW 9 119220769 intron probably null
R6622:Slc22a14 UTSW 9 119170577 missense possibly damaging 0.81
R6948:Slc22a14 UTSW 9 119231416 missense probably damaging 1.00
R7027:Slc22a14 UTSW 9 119231215 intron probably null
R7731:Slc22a14 UTSW 9 119170611 missense possibly damaging 0.95
R7985:Slc22a14 UTSW 9 119170638 missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- GGAGTGAATCACAAGTCAGCACCC -3'
(R):5'- AATGTAGCAAGCCTGAGCCTGAAG -3'

Sequencing Primer
(F):5'- GTCTAGAACTTGAGGCCATGAATC -3'
(R):5'- AGATAACTCTCCTCATGGACTATGC -3'
Posted On2013-07-11